ID: 1050552074

View in Genome Browser
Species Human (GRCh38)
Location 9:6757626-6757648
Sequence CGCGCGTCGGAGGCCGCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050552067_1050552074 1 Left 1050552067 9:6757602-6757624 CCCCGGTAACGCCACGCTGACGT 0: 1
1: 0
2: 0
3: 2
4: 11
Right 1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 25
1050552068_1050552074 0 Left 1050552068 9:6757603-6757625 CCCGGTAACGCCACGCTGACGTC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 25
1050552065_1050552074 12 Left 1050552065 9:6757591-6757613 CCGAGGCTCCACCCCGGTAACGC 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 25
1050552069_1050552074 -1 Left 1050552069 9:6757604-6757626 CCGGTAACGCCACGCTGACGTCC 0: 1
1: 0
2: 0
3: 8
4: 16
Right 1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 25
1050552070_1050552074 -10 Left 1050552070 9:6757613-6757635 CCACGCTGACGTCCGCGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 25
1050552066_1050552074 4 Left 1050552066 9:6757599-6757621 CCACCCCGGTAACGCCACGCTGA 0: 1
1: 0
2: 0
3: 6
4: 22
Right 1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 25
1050552063_1050552074 22 Left 1050552063 9:6757581-6757603 CCAGTACATTCCGAGGCTCCACC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050552074 Original CRISPR CGCGCGTCGGAGGCCGCCAT AGG Intronic
1089524146 11:119085627-119085649 CGTGGGTGGGAGGCCGCCGTGGG + Intronic
1098106089 12:67069715-67069737 CGCGCCTCGCAGGCCGCCCGGGG - Intergenic
1108389894 13:49937011-49937033 GGCGCGTGGGAGGCCGCCCTGGG + Intergenic
1108689557 13:52848704-52848726 CGCGAGGGGGAGGCGGCCATTGG - Intergenic
1118874068 14:69767765-69767787 CGCGCCCGCGAGGCCGCCATTGG + Intronic
1152354249 17:79799007-79799029 CGCCCGTGGGAGGCCGCCGACGG + Intronic
1160763698 19:797935-797957 CGCGCGTGCGCGGCCGCCATCGG + Intronic
1166367213 19:42283938-42283960 CGCGCGGCGGCGGCAGCCAATGG + Intronic
1169327452 20:4686972-4686994 CGCCCCTCGGAGGCCGAGATCGG + Intronic
1171010358 20:21506050-21506072 CGCGCGGCCGACGCCGCCAGGGG + Intergenic
1171123255 20:22583069-22583091 AGCATGTCGGCGGCCGCCATGGG - Exonic
1184276498 22:43412012-43412034 CGCGCGTCCGAGGCTGCAAGTGG - Intronic
976765268 4:88592366-88592388 CGTGCCACGGCGGCCGCCATTGG + Intronic
979253802 4:118591753-118591775 CGCGCCTCTGACGCCGCCAAAGG - Intergenic
979623970 4:122826581-122826603 CGCGCGTCGGAGGCCGCGGCAGG - Intergenic
983656499 4:170090030-170090052 CGCGCGCCGCGGGCGGCCATAGG - Intronic
985895515 5:2748413-2748435 CCCGCGTCGCTGGCCGCCTTTGG + Exonic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020204589 7:6105053-6105075 CGCCCGCCGCAGGCCGGCATGGG + Intronic
1020281794 7:6653592-6653614 CGCGCGTTCGGGCCCGCCATCGG + Exonic
1028223234 7:88220257-88220279 CGCAGGTCGTAGGCCGCCACTGG - Intronic
1030093338 7:105876702-105876724 CGCGCGCCCGCGGCCGCCAGGGG + Intergenic
1030227450 7:107169081-107169103 CGCGCGGGGGAGGCCGACGTCGG + Exonic
1041792577 8:61714107-61714129 CGCGGGGCGGAGGCCGCATTCGG - Intronic
1049746995 8:144267202-144267224 GGCGCGTTGGAGGCCCCCCTCGG - Intronic
1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG + Intronic
1056801986 9:89698790-89698812 CCCGCGTCTGAGTCGGCCATGGG - Intergenic
1190532805 X:51396381-51396403 CGCGCCTCGGCGGCAGCCACAGG - Intergenic
1196424974 X:115561109-115561131 CGCCCCTCGGCCGCCGCCATTGG - Intergenic