ID: 1050552251 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:6758388-6758410 |
Sequence | GGCCGCAGGGGAGGGATGCG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1050552233_1050552251 | 23 | Left | 1050552233 | 9:6758342-6758364 | CCGTGACTGCAGCGACTGTCAAG | No data | ||
Right | 1050552251 | 9:6758388-6758410 | GGCCGCAGGGGAGGGATGCGGGG | No data | ||||
1050552232_1050552251 | 27 | Left | 1050552232 | 9:6758338-6758360 | CCGTCCGTGACTGCAGCGACTGT | No data | ||
Right | 1050552251 | 9:6758388-6758410 | GGCCGCAGGGGAGGGATGCGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1050552251 | Original CRISPR | GGCCGCAGGGGAGGGATGCG GGG | Intronic | ||