ID: 1050552251

View in Genome Browser
Species Human (GRCh38)
Location 9:6758388-6758410
Sequence GGCCGCAGGGGAGGGATGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050552233_1050552251 23 Left 1050552233 9:6758342-6758364 CCGTGACTGCAGCGACTGTCAAG No data
Right 1050552251 9:6758388-6758410 GGCCGCAGGGGAGGGATGCGGGG No data
1050552232_1050552251 27 Left 1050552232 9:6758338-6758360 CCGTCCGTGACTGCAGCGACTGT No data
Right 1050552251 9:6758388-6758410 GGCCGCAGGGGAGGGATGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050552251 Original CRISPR GGCCGCAGGGGAGGGATGCG GGG Intronic