ID: 1050552981

View in Genome Browser
Species Human (GRCh38)
Location 9:6763588-6763610
Sequence GAAAATGCACATAAACACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 982
Summary {0: 1, 1: 1, 2: 32, 3: 212, 4: 736}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050552981_1050552983 18 Left 1050552981 9:6763588-6763610 CCTTTGTGTTTATGTGCATTTTC 0: 1
1: 1
2: 32
3: 212
4: 736
Right 1050552983 9:6763629-6763651 TCAGTGTTACCATTGTGAAGAGG No data
1050552981_1050552984 19 Left 1050552981 9:6763588-6763610 CCTTTGTGTTTATGTGCATTTTC 0: 1
1: 1
2: 32
3: 212
4: 736
Right 1050552984 9:6763630-6763652 CAGTGTTACCATTGTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050552981 Original CRISPR GAAAATGCACATAAACACAA AGG (reversed) Intronic
900390962 1:2433717-2433739 GAAAATACAGAAAAAGACAAGGG + Intronic
900902325 1:5525646-5525668 GAAAATTCAGAGAAATACAAAGG - Intergenic
901508781 1:9703754-9703776 CCAAATGCACATCAACAGAATGG - Intronic
902326997 1:15707591-15707613 CAAAATCCACATGAACAGAAAGG + Intronic
902419187 1:16264334-16264356 AAAAAGGCACATAACCACTATGG + Intronic
902439927 1:16422492-16422514 AAAAATACACACACACACAAAGG - Intronic
903082828 1:20825519-20825541 CTGAATGCACATAAATACAATGG + Intronic
903527520 1:24003262-24003284 GAAATTCTGCATAAACACAAAGG - Intergenic
904218476 1:28943991-28944013 GAAAATCTACATATACACATTGG + Intronic
906644027 1:47460077-47460099 GAAAATCCACAAAAACCCACTGG - Intergenic
906882985 1:49613012-49613034 GAAAATGTACATATACATCATGG + Intronic
906954842 1:50365194-50365216 GATAAGGCACATATACACCATGG + Intergenic
906989952 1:50726848-50726870 GAAAATGTACATAATTAAAATGG + Intronic
907424069 1:54367820-54367842 GTTTGTGCACATAAACACAATGG - Intronic
907440092 1:54473630-54473652 CAAAAAGCTCAGAAACACAATGG + Intergenic
907559203 1:55373198-55373220 TAAAACTCACACAAACACAATGG - Intergenic
907637446 1:56150352-56150374 CAACATGCACAAAAGCACAATGG + Intergenic
907717850 1:56944240-56944262 GAAAATGCATATAAAAAGTAAGG + Intronic
908044653 1:60155424-60155446 GCCAATGGACATAAACACCAAGG - Intergenic
908874132 1:68650437-68650459 GAAAATGCAAATAAACATCATGG - Intergenic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909511140 1:76453819-76453841 GAAAATGAACAAAGAAACAATGG - Intronic
909520124 1:76558372-76558394 GAAAATGTACATATACACCATGG + Intronic
909598033 1:77428960-77428982 GAAAAGGCACATATACACCGTGG - Intronic
909722119 1:78785687-78785709 AAAATTCCACTTAAACACAACGG + Intergenic
909821541 1:80068806-80068828 CAAAATGTAAATAAACAAAAAGG - Intergenic
910139729 1:84013860-84013882 GAAAATGTACATATACGCCATGG + Intergenic
910148230 1:84108106-84108128 GAAAATGTACATATACACCATGG + Intronic
910166687 1:84335953-84335975 TAAAAGGCAGATAAAGACAAGGG - Intronic
910896768 1:92078097-92078119 TAAAAAGTACATAAACAGAAAGG - Intergenic
911630885 1:100182104-100182126 GAAAATGCATATGTACACAATGG - Intergenic
911882221 1:103254482-103254504 CAAAATGTACATAGACACAGAGG + Intergenic
912610458 1:111037380-111037402 GAAAATGTACATATGCATAATGG + Intergenic
913282159 1:117196495-117196517 GAAAATACAAAAAAGCACAAAGG - Intronic
913378026 1:118176147-118176169 GAAAAATCACCTAATCACAAAGG + Intronic
913417958 1:118633277-118633299 GAAAGTCAACAAAAACACAATGG - Intergenic
913431968 1:118805105-118805127 GACAATGCAGAGGAACACAAAGG + Intergenic
913567647 1:120088783-120088805 GAAAATGTACATACATACCATGG - Intergenic
914288393 1:146249491-146249513 GAAAATGTACATACATACCATGG - Intergenic
914549429 1:148700237-148700259 GAAAATGTACATACATACCATGG - Intergenic
914617252 1:149371481-149371503 GAAAATGTACATACATACCATGG + Intergenic
914693729 1:150055666-150055688 GAAAATGTACGTATACACCATGG + Intergenic
914697942 1:150102653-150102675 GAAAATGTACATATACACCATGG + Intronic
914969996 1:152300072-152300094 GAAAGTGTACCTACACACAATGG + Intergenic
915925323 1:160013697-160013719 GAAAATGTATATATACACAATGG + Intergenic
916897402 1:169179588-169179610 GAAAATGTACATATACACCATGG + Intronic
917559851 1:176138816-176138838 GAAAATGTCCATGAACCCAAAGG - Intronic
918657790 1:187050141-187050163 GAAAATGTATATAAATACAAAGG + Intergenic
918794723 1:188878658-188878680 TAAAATGCACAGAAAAACAGGGG + Intergenic
919194159 1:194262697-194262719 GAAAATGTACATATACAACATGG + Intergenic
920284444 1:204869362-204869384 GAAAAGATAAATAAACACAAAGG + Intronic
921295653 1:213699419-213699441 GAAAATGTACTTATACACAACGG - Intergenic
921457248 1:215386833-215386855 GAAAATATACATATACACAATGG + Intergenic
921634906 1:217480766-217480788 GAAAATGTACATATACATAATGG + Intronic
921760483 1:218908177-218908199 TAAAATATACATATACACAATGG - Intergenic
921776539 1:219106920-219106942 AGAAATGCACATTAAAACAACGG - Intergenic
921818585 1:219591515-219591537 GAAAATGTAGAAAAGCACAAAGG - Intergenic
921905912 1:220495463-220495485 GAAAATGACAATAAACACATTGG - Intergenic
922138198 1:222853521-222853543 GAAAATGTATATATACACCACGG + Intergenic
923000239 1:230001188-230001210 CAAAATGAACATAACCAGAATGG + Intergenic
923085369 1:230699158-230699180 GAAAATGTAGATATACACCATGG - Intergenic
923311144 1:232736784-232736806 GAAAAAGATCCTAAACACAAAGG - Intergenic
923685403 1:236149931-236149953 GCATATGCACATACACACACAGG - Intronic
924269375 1:242316972-242316994 GAAAATGTGCATATACACCATGG - Intronic
924394123 1:243599264-243599286 GAAAATGTATACCAACACAAAGG + Intronic
924702291 1:246466306-246466328 GAAAATGTACCTATACACCATGG + Intronic
924769836 1:247069624-247069646 GAAAATGTACATACACACAGTGG + Intronic
1063450977 10:6149941-6149963 GAAAATGTACATATACAACATGG - Intronic
1063566584 10:7176718-7176740 TTAAATGGACAGAAACACAATGG + Intronic
1063686213 10:8239475-8239497 CAAAATGCACATCTAAACAAAGG - Intergenic
1063748637 10:8916633-8916655 GAAAATGTAAATATACACCATGG + Intergenic
1063819305 10:9816481-9816503 GAAAATTTACATATACACCATGG - Intergenic
1064550920 10:16500045-16500067 GAAAATGCAGTTAAAAAAAAAGG - Intronic
1064572339 10:16707105-16707127 GAAAATGTATATATACATAATGG - Intronic
1064798291 10:19039119-19039141 GAAAATGTACATATACACCATGG + Intergenic
1065146433 10:22772832-22772854 AAAAATGTACATATACACCATGG - Intergenic
1065640073 10:27772619-27772641 GAAAATGTATATATACACCATGG - Intergenic
1065653039 10:27914111-27914133 GAAAATGTACATACAAACCATGG + Intronic
1066112178 10:32207243-32207265 TAAAATGCAAATAATCTCAAGGG - Intergenic
1066173647 10:32879912-32879934 GAAAATGTACATATACACCATGG - Intronic
1066191993 10:33064515-33064537 GAAAATGAACTAATACACAAGGG + Intergenic
1066229955 10:33422555-33422577 GAAAACACACACATACACAAGGG - Intergenic
1066356946 10:34694050-34694072 GAAAATGCAGAAACATACAAAGG - Intronic
1066792723 10:39083670-39083692 GAATATGCAAATAAATACTAGGG + Intergenic
1067016756 10:42762311-42762333 GAAAATGTGCATATATACAATGG - Intergenic
1067540369 10:47146524-47146546 GAAAATGCACTCAGCCACAATGG - Intergenic
1067929813 10:50549324-50549346 GAAAATGTACATATACACCATGG + Intronic
1068094669 10:52476067-52476089 AAGAATGCACCTCAACACAAAGG + Intergenic
1068217888 10:54007137-54007159 GAAAATACACAGAAAGAAAAGGG - Intronic
1068422519 10:56814107-56814129 TAAAATGGAGATAAACACAATGG + Intergenic
1068559833 10:58501676-58501698 AAAAGAGCAAATAAACACAATGG - Intergenic
1068642030 10:59419983-59420005 GAAAATGTACTTATACATAATGG + Intergenic
1068973813 10:62986658-62986680 TAAAATGCACATAAAAACTCCGG + Intergenic
1069294022 10:66821336-66821358 GAATATGCCCATAAAGACAAGGG - Intronic
1069327014 10:67243396-67243418 GGAAGTGCACGTGAACACAAGGG + Intronic
1069328591 10:67262814-67262836 GAGAATGCAAAATAACACAAAGG + Intronic
1069389794 10:67921597-67921619 CAAAATGCAAATAAGCCCAAGGG - Intergenic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1069605209 10:69734582-69734604 GAACATGCACACACACACAGAGG + Intergenic
1069875289 10:71559252-71559274 AAAAATGCACAAATCCACAAGGG - Intronic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1070720426 10:78753126-78753148 GAAAAGGCACAGAGACACAAGGG - Intergenic
1070772979 10:79093211-79093233 GATAATGCACATAAACTGCATGG - Intronic
1070940144 10:80337283-80337305 GAAAATGCCAATGAACAAAATGG - Intronic
1071016915 10:81008330-81008352 GAAAATGCATAAAAACAGTAAGG + Intergenic
1071022650 10:81076787-81076809 GGAAATGTACATATACACCACGG - Intergenic
1071111168 10:82158688-82158710 GAAAAAGTACATAAGCCCAAAGG - Intronic
1071254291 10:83855508-83855530 GAAAACTCACAAAAACATAAAGG - Intergenic
1071262406 10:83932701-83932723 AAAAATGAACAAAAACAAAAAGG + Intergenic
1071349483 10:84725470-84725492 GAAAATGCACAAACAAACAGTGG - Intergenic
1071605819 10:86987849-86987871 GAAAATGTGCATATATACAATGG - Intergenic
1071667356 10:87572629-87572651 GAAAATGTATATATACACAAAGG + Intergenic
1071949958 10:90692267-90692289 GAAAATGTATATACACACAATGG - Intergenic
1072042621 10:91623526-91623548 GAAAAGGAACATAAACAAATGGG + Intergenic
1072804549 10:98416365-98416387 GAAAATACAGAAAAACATAAAGG - Exonic
1073828093 10:107349051-107349073 GAAAAGGCACATATATACCATGG - Intergenic
1074315474 10:112357486-112357508 GAAAATCCACATGAATATAAAGG + Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074730819 10:116373299-116373321 GAAAATGAAGTTAAACATAAAGG + Intronic
1075188079 10:120281375-120281397 GGAAATGCACATATACACCATGG + Intergenic
1075294946 10:121266830-121266852 GAAAAAGCAAATAAAAACACAGG + Intergenic
1075354873 10:121762525-121762547 GAAAATCCACACAGACACAGGGG - Intronic
1075500503 10:122969439-122969461 GAAAATGTACATATACACCATGG + Intronic
1075525361 10:123180410-123180432 GAAAATGTGTATACACACAATGG + Intergenic
1075666790 10:124236779-124236801 TAAAATGCAAGTAAACAAAAAGG + Intergenic
1075837715 10:125469888-125469910 GAAAGTGCATATGATCACAAAGG - Intergenic
1075860352 10:125669957-125669979 GAAAATGTACATGTACACCACGG - Intronic
1076095059 10:127726689-127726711 GGAAATGCAAATAAAAACTAAGG + Intergenic
1076977793 11:188574-188596 AAAAATACACATTAACAAAATGG + Intronic
1077770380 11:5211737-5211759 GAACATGTACATATACACCATGG - Intergenic
1077822461 11:5761642-5761664 GAATATGCATAAAAACTCAACGG - Intronic
1077952092 11:6970574-6970596 GAAAATACAGAGAAAAACAAGGG + Intronic
1078113271 11:8418448-8418470 GAAAATGTACATATACACCATGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078556833 11:12334813-12334835 GAAAATGTACATATACACCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1078634120 11:13033113-13033135 GGAAATGCAGATAAACAGGATGG + Intergenic
1078645625 11:13139280-13139302 GAAAATGTACATATACATCATGG - Intergenic
1078767862 11:14316985-14317007 GAAAATGCACCTAATTACAGAGG + Intronic
1079464540 11:20716343-20716365 AAAAATACACACAAGCACAAAGG + Intronic
1079634585 11:22720166-22720188 GAATATTCACATACACAAAAAGG - Intronic
1080351627 11:31391880-31391902 AAAAATGTATATATACACAACGG + Intronic
1080377364 11:31728794-31728816 GAAAGTACACATGAACACTAAGG - Intronic
1080643560 11:34172745-34172767 GATAATGCACATAAAGAGGAAGG + Intronic
1081626344 11:44658063-44658085 GAACATGCTTATAAAAACAATGG + Intergenic
1082025678 11:47569819-47569841 TACAATGCACGTAAACACACTGG - Exonic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1083060652 11:59867313-59867335 GCAAATGTACATATACACAATGG + Intergenic
1084796527 11:71509685-71509707 GAAAATGTGTATATACACAATGG + Intronic
1084969286 11:72761418-72761440 GAAAATTTACAGAAACAAAATGG + Intronic
1085594697 11:77798618-77798640 AAAAAGGCACATATACACCATGG + Intronic
1085682486 11:78590668-78590690 GAAAATGTACATGCACACAATGG + Intergenic
1086178756 11:83924132-83924154 GAAAATGCCCAGAAAAACAAGGG + Intronic
1086483715 11:87273865-87273887 AAAAATGCAAATAAACAATAAGG - Intronic
1086929679 11:92679158-92679180 GAAAATGTATATATACACAATGG - Intronic
1087010151 11:93506107-93506129 GAATATGCACACACACACACGGG + Intronic
1087606061 11:100379682-100379704 GAAAATGTGTATAAACACAATGG + Intergenic
1087661180 11:100989869-100989891 GAAACAGAAAATAAACACAAAGG + Exonic
1087720723 11:101662495-101662517 GAAAATGTACATATATACCATGG - Intronic
1087837538 11:102889975-102889997 GAAAATACAGAAAAATACAAAGG - Intergenic
1088025156 11:105170878-105170900 AAAAATGTACATATACACCATGG - Intergenic
1088176999 11:107064914-107064936 GGCATTGGACATAAACACAAAGG - Intergenic
1088273838 11:108063410-108063432 GAAAATGTACATAAACACAATGG - Intronic
1088420385 11:109638567-109638589 GAAAATGTACATACACACAATGG - Intergenic
1088497999 11:110451716-110451738 GAAAATGTACATATACACCATGG + Intronic
1088702247 11:112423720-112423742 GAAAATACACTCACACACAAAGG - Intergenic
1090630468 11:128643060-128643082 GAAAATGTATATATACACCATGG + Intergenic
1091006407 11:131957610-131957632 GACAATACACATAAAAATAAAGG + Intronic
1091488224 12:910108-910130 GAAACTGAACATAAAGAGAAGGG + Exonic
1092189392 12:6507384-6507406 GAAAATGAACATTCAAACAAAGG + Intronic
1092456137 12:8644613-8644635 GAAAATGCTCAAAGATACAAGGG + Intronic
1093097765 12:14991542-14991564 GAAAATGTACATATACACCATGG + Intergenic
1093419466 12:18958209-18958231 GAAAATGTACACATACACAATGG - Intergenic
1093693304 12:22132016-22132038 TATAATGCACATCAACTCAAAGG + Intronic
1093874497 12:24333428-24333450 CAAAATGCAGATAAACTTAACGG + Intergenic
1093947367 12:25124980-25125002 GAAAATGTACATACCCACCATGG - Intronic
1093984987 12:25520563-25520585 GAAAATGTAGCTATACACAATGG - Intronic
1094377706 12:29808922-29808944 GAAAATCCATATTTACACAAAGG + Intergenic
1094782561 12:33808851-33808873 ACATATGCACACAAACACAATGG - Intergenic
1095130085 12:38530731-38530753 GAAAATGTACATTTACACCATGG - Intergenic
1095195597 12:39312152-39312174 GAAAATGTACATACACACAATGG + Intronic
1095258978 12:40076515-40076537 GAAAATGTACATATACACCATGG - Intronic
1095391048 12:41707061-41707083 GAAAATGTACATATACACCATGG - Intergenic
1095582999 12:43821270-43821292 AAAAATACACATAAGCACATGGG + Intergenic
1095590226 12:43894753-43894775 GAAAATGTACATACACACCATGG - Intronic
1095920972 12:47530908-47530930 GAAAATACACAAAAACTCATTGG - Intergenic
1095921657 12:47537931-47537953 GAAAAGGCACATAAACATTCTGG + Intergenic
1097367847 12:58739845-58739867 GAAAATGTACATATACACCATGG - Intronic
1097375335 12:58836407-58836429 GAAAATGTACATATACACCATGG - Intergenic
1097431395 12:59512285-59512307 GCAAGTGTACATACACACAAAGG + Intergenic
1097464975 12:59910985-59911007 GAAAATGTACAGAAAATCAATGG + Intergenic
1097600682 12:61688691-61688713 AAAAATGTACATATACACCATGG - Intergenic
1097619094 12:61918517-61918539 GAAAATGTACACATACACAATGG - Intronic
1098481737 12:70969681-70969703 GAAAATGTATATATACACCAAGG - Intergenic
1098747410 12:74256786-74256808 TAAACTGTACATAAACACATAGG + Intergenic
1098938915 12:76512332-76512354 GAAAATGTACATATACACCATGG - Intronic
1099092955 12:78337060-78337082 GGAAATGTACATATACACAATGG + Intergenic
1099336004 12:81358463-81358485 GAAAATGATAATAAACAGAAAGG - Intronic
1100049548 12:90430230-90430252 GAAAATGCAAATTAAAACCAGGG - Intergenic
1100454531 12:94739588-94739610 GAAAATGTGCATATACACCATGG - Intergenic
1100582639 12:95949554-95949576 GAAAATACAGATGAACAAAAAGG + Intronic
1100869796 12:98897844-98897866 GAAAATGTAAATATACACCATGG + Intronic
1101476437 12:105053684-105053706 TATAACCCACATAAACACAATGG - Intronic
1101503236 12:105323957-105323979 AAAAGTGCAAATAAACACTACGG + Intronic
1101877418 12:108605004-108605026 GAAAACACACATCCACACAAAGG + Intergenic
1101910308 12:108856501-108856523 ATAGATGCACATAAACACACAGG + Intronic
1102098055 12:110256222-110256244 GAAAATGTAAATCAACTCAAAGG - Intergenic
1102423424 12:112822062-112822084 GAAAATGTACTTTAACAAAAGGG - Intronic
1102814563 12:115854038-115854060 AAAAATGTACATATACACTATGG - Intergenic
1103866877 12:124059661-124059683 GAAAATGTACATATACACCATGG - Intronic
1104147793 12:126052637-126052659 GAAAATGCACAGTAAAACCACGG + Intergenic
1104262353 12:127196101-127196123 GAAAATGTACATATACATCATGG + Intergenic
1104567449 12:129898054-129898076 GAATTTGCAGATAAACTCAATGG - Intronic
1105459958 13:20575316-20575338 GAAAATGTACATATATACAATGG - Intronic
1105680170 13:22717961-22717983 GAAAAATCACACAAACACACAGG + Intergenic
1105946436 13:25194204-25194226 GGAAATGCAAATTAAAACAATGG + Intergenic
1105976222 13:25475379-25475401 GAAAATGTACATATACACTATGG - Intronic
1106048465 13:26167828-26167850 GAAAATGTACATATACACCATGG + Intronic
1106114446 13:26805185-26805207 GAAAAAAGACATTAACACAAAGG + Intergenic
1106678832 13:31989080-31989102 GACAATGTATATATACACAATGG - Intergenic
1107350617 13:39510644-39510666 GAAAACACACACACACACAATGG + Intronic
1107563092 13:41575044-41575066 GAAAATGTATATATACACCATGG + Intronic
1107821465 13:44289432-44289454 GAGAATGCACAGAGACACAGAGG - Intergenic
1108049732 13:46421284-46421306 GAAATAGCACAAAAACAGAAAGG - Intronic
1108650018 13:52468738-52468760 GAAAATGTACATATACACCATGG - Intronic
1109156373 13:58915136-58915158 GAAAATTAACATAAAGAGAAGGG + Intergenic
1109167582 13:59055297-59055319 GAAAATGTACATATACACCATGG + Intergenic
1109463937 13:62702128-62702150 CAAAATTCACATTATCACAATGG + Intergenic
1109553034 13:63930915-63930937 AAAAATGCACAGAAACACTCTGG + Intergenic
1109618002 13:64862507-64862529 GAAAATCAACAAAGACACAATGG - Intergenic
1109801594 13:67386011-67386033 GAAAATGTACATATTCACCATGG - Intergenic
1109961189 13:69634192-69634214 AAAAATGTACATAGAAACAATGG - Intergenic
1110007391 13:70290110-70290132 GAAAATGTACATAAACATCATGG + Intergenic
1110052394 13:70920816-70920838 GAAAAAACACATAATCCCAATGG - Intergenic
1110128252 13:71975437-71975459 GAAAATGTACATACACACAATGG - Intergenic
1110319491 13:74144715-74144737 GAAAGGGCAAATAAATACAACGG + Intergenic
1110442698 13:75542964-75542986 GAAAATGTACATATACACCATGG + Intronic
1110556558 13:76866246-76866268 GAAAATGTGTATATACACAATGG - Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111364770 13:87228127-87228149 GAAAATGTACCTATATACAATGG - Intergenic
1111476057 13:88749369-88749391 GAAATAGCACAGAATCACAAGGG - Intergenic
1112598175 13:100829245-100829267 GAAAAAGCACAAAAATAAAAAGG + Intergenic
1112704628 13:102053102-102053124 GAAAAATCACCTAATCACAAAGG + Intronic
1112718709 13:102217016-102217038 GAAAATGTACATCTACACAGTGG - Intronic
1113053317 13:106238657-106238679 GACACTGCACAGTAACACAATGG - Intergenic
1113208983 13:107952644-107952666 GAAAATGTACGTACACACAACGG + Intergenic
1113331910 13:109335609-109335631 GAAAATGCATTTAAACCTAAAGG + Intergenic
1113344213 13:109458248-109458270 GAAAATGTATATATACACTATGG - Intergenic
1113873461 13:113579329-113579351 GAAAATGCACCTAAACACGGTGG + Intergenic
1114216039 14:20658471-20658493 GGAAGTGGACATAAACTCAATGG - Intergenic
1114338961 14:21723333-21723355 GAAAATGCACAGAAAAAGAAAGG - Intergenic
1114452129 14:22834265-22834287 GAAAATGCTCTTAAACCCAAAGG + Exonic
1114506985 14:23224083-23224105 GAGAACACACATACACACAAAGG + Intronic
1114561809 14:23598219-23598241 GAAAAATCACTTAACCACAACGG - Intergenic
1115046094 14:28996032-28996054 GAAAATTTACATAGACATAAAGG - Intergenic
1115257561 14:31419608-31419630 ATGAATGCACATAAAAACAATGG + Intronic
1115655932 14:35443625-35443647 GCATATTCACATATACACAAAGG + Intergenic
1115670479 14:35606407-35606429 GTAAATACACCTAAACAGAAAGG + Intronic
1115912303 14:38269916-38269938 AAAAATGTACATATACACCATGG + Intergenic
1115965900 14:38887874-38887896 GGAAGTACACATAAACTCAACGG + Intergenic
1116080604 14:40166053-40166075 GAAAATGTACATATACGCAATGG + Intergenic
1116224104 14:42126093-42126115 GAAAATGTACATATGCACTATGG + Intergenic
1116224108 14:42126178-42126200 GAAAATGTACATATGCACTATGG + Intergenic
1116906604 14:50409810-50409832 GAAAATGTACATACATGCAATGG - Intronic
1117482581 14:56162473-56162495 GAAAATGTACATATACGCAATGG - Intronic
1117686007 14:58253929-58253951 GAAAATGTATATATACACAATGG - Intronic
1117800717 14:59442178-59442200 GAAACTGCACAATAAGACAAGGG - Intronic
1118146937 14:63147899-63147921 GTAAATGTACATATACACCATGG - Intergenic
1118544050 14:66864898-66864920 GAAAATGTACATCTACACAATGG + Intronic
1118830034 14:69422247-69422269 GAAAATAAACAAAACCACAAGGG - Intronic
1118890621 14:69905435-69905457 GACAAGGCACCTACACACAAAGG + Intronic
1120075253 14:80149404-80149426 GAAAATGGATATATACACAATGG - Intergenic
1120137060 14:80882695-80882717 GAAAATGTACTTATACACAACGG + Intronic
1120351178 14:83360704-83360726 GAGAATAAACATAAAGACAATGG - Intergenic
1120501382 14:85301177-85301199 TAAAATGCACAGAATTACAAAGG + Intergenic
1120619193 14:86742189-86742211 GAAAATGTTCATATACACAGTGG - Intergenic
1120625115 14:86815862-86815884 GAAAATGTACATATATACCATGG + Intergenic
1120869807 14:89327075-89327097 GAAAAAGCACATGTACACATAGG + Intronic
1120966999 14:90176332-90176354 CATAATCCACATAAATACAATGG + Intronic
1122002907 14:98678421-98678443 GAAAATGTATATACACACAATGG - Intergenic
1124040887 15:26102449-26102471 GGAAATGCAAATTAAAACAATGG - Intergenic
1124078404 15:26468664-26468686 GAAAATGTACATGTACACCATGG + Intergenic
1124561118 15:30774267-30774289 CAAACTGCACAGAAACACATGGG - Intergenic
1124669412 15:31624792-31624814 CAAACTGCACAGAAACACATGGG + Intronic
1125119775 15:36141259-36141281 GAAAATGCATAAACACACCATGG - Intergenic
1126269577 15:46798772-46798794 GAAAGTGTACATATACACAATGG + Intergenic
1126314985 15:47360648-47360670 GAACATGCAGATTTACACAAAGG + Intronic
1126320136 15:47413113-47413135 GTAAATACACATACACACAGAGG - Intronic
1126489456 15:49220444-49220466 GAAAATGTATATATACACAATGG - Intronic
1126980533 15:54237725-54237747 GATATTGCTCATAATCACAAGGG + Intronic
1126985974 15:54308868-54308890 GAAAATGTATATACATACAATGG - Intronic
1126992571 15:54398375-54398397 CAATATCCTCATAAACACAAAGG - Intronic
1127154876 15:56113282-56113304 GAAAATGTACATATACACCATGG + Intronic
1127155273 15:56117831-56117853 GAAAATGTATATATACACAATGG - Intronic
1127169666 15:56287881-56287903 GAAAATATATATATACACAACGG - Intronic
1127174059 15:56335279-56335301 GAAAATGTACATATACACAATGG + Intronic
1127224496 15:56916171-56916193 GAAAATGAACTAAAACACATGGG + Intronic
1128057177 15:64708879-64708901 AAAAATGTACATATAGACAACGG - Intergenic
1128917562 15:71578093-71578115 GATAATGTACACAGACACAAGGG - Intronic
1129559275 15:76549389-76549411 AAATATGCACATATACACCATGG + Intronic
1129593976 15:76944739-76944761 GAAAATGTACATATACACAATGG - Intronic
1129866391 15:78911902-78911924 GAAAATGTATATATACACAGTGG + Intergenic
1130085548 15:80776122-80776144 AAAAATACAGAAAAACACAAAGG - Intergenic
1130398587 15:83528395-83528417 GAAAATGAAGAGAAAGACAAAGG - Intronic
1130439432 15:83937290-83937312 AAAAATGTACATATACACCATGG + Intronic
1130768490 15:86899168-86899190 GAAAATGTACATATACACCATGG + Intronic
1131414436 15:92241353-92241375 GAAAATGTATATATACACAATGG - Intergenic
1131591351 15:93752421-93752443 GAAAATGTACATTTACACCATGG + Intergenic
1131685365 15:94761799-94761821 AAATATGTACATAAACACAGTGG + Intergenic
1131747745 15:95467962-95467984 GAAAATTCAGATAAACATATAGG + Intergenic
1132131096 15:99280591-99280613 AAAAAGACACATACACACAAAGG - Intronic
1133275860 16:4638100-4638122 AAAAATGCCAATTAACACAAAGG - Intronic
1133800017 16:9077617-9077639 GAAAAGGTGCATAAACACAGTGG + Intergenic
1134782610 16:16912021-16912043 GAAAATGGACTAACACACAAGGG + Intergenic
1134847658 16:17454265-17454287 CCAAATGCCCATAAACAGAATGG + Intronic
1135199563 16:20425345-20425367 GAAGATGTACATATACACAATGG - Intronic
1135219131 16:20598263-20598285 GAAAATGTACATATACACAATGG + Intergenic
1135837947 16:25844831-25844853 GAAAATGTACATATACACCAGGG + Intronic
1135989843 16:27211389-27211411 GAACAGGCACATAGACCCAAGGG - Intronic
1137356978 16:47776393-47776415 GAAAATGTACCTATACAGAATGG + Intergenic
1137824382 16:51478169-51478191 GAAAATGTATATATACACAATGG - Intergenic
1138218816 16:55231760-55231782 GAAATTGTACATATACACGATGG - Intergenic
1138303194 16:55949653-55949675 GACAATGAAAATAAACACAAAGG + Intronic
1138941510 16:61796439-61796461 GAAACTTCTCATTAACACAATGG + Intronic
1139151344 16:64385796-64385818 GAAAATGGACGAACACACAAGGG - Intergenic
1139562559 16:67752884-67752906 GAAAATGTAAATAAACAAATAGG + Intronic
1139641026 16:68291519-68291541 GAAAAGGCACTTAAACGCACAGG - Intronic
1140104688 16:71948941-71948963 GAAAATAAATATAAATACAAAGG - Intronic
1140125529 16:72114891-72114913 GGAAATGTACATACACACCATGG - Intronic
1140655796 16:77138001-77138023 GAAAATGTACATATACACCATGG - Intergenic
1140728926 16:77838680-77838702 GGAAATGGACAGAAAGACAAAGG - Intronic
1141226727 16:82123347-82123369 GAAAATCCAAATAAATAAAATGG + Intergenic
1141795395 16:86269885-86269907 GAAAAAGCAAATTAACCCAAAGG - Intergenic
1142442537 16:90108755-90108777 AAAAATACACATTAACAAAATGG - Intergenic
1142465214 17:133039-133061 AAAAATACACATTAACAAAATGG + Intergenic
1143467352 17:7146392-7146414 GAAACTGCAGAGAAAAACAAAGG + Intergenic
1143601688 17:7950740-7950762 GAAAATGTACATATACACCATGG + Intergenic
1143701231 17:8661800-8661822 GAAATGGCACATAACAACAAAGG - Intergenic
1143702106 17:8668449-8668471 GAAAATGTATATAGACACAATGG - Intergenic
1144712835 17:17413716-17413738 GAAAATGCAAATGAAGACCAGGG - Intergenic
1145074426 17:19839929-19839951 CAAAATGCACACATACACAAAGG + Intronic
1145212273 17:21022959-21022981 GAAAATGTACATATATACCATGG + Intronic
1145332490 17:21884435-21884457 GGAAATGCACTCAAACAGAATGG + Intergenic
1147797141 17:43052506-43052528 GCAAATTCTCATAAACACACTGG + Intronic
1148334379 17:46831905-46831927 GAAAGGGCACAGGAACACAAAGG - Intronic
1148348245 17:46918794-46918816 CATAATGCACAAAAAGACAAAGG - Intergenic
1148947188 17:51273796-51273818 GAAAATGAAGATAAACCAAACGG - Intronic
1148957241 17:51363971-51363993 AAAAACACACATATACACAAGGG - Intergenic
1149153979 17:53604172-53604194 GCAAATGCAAGTAAATACAAAGG - Intergenic
1149300007 17:55296427-55296449 ATAAATGCTTATAAACACAAAGG - Intronic
1149916984 17:60619246-60619268 GAAAATGTATGTATACACAATGG - Intronic
1149999294 17:61423327-61423349 GAAAAGTCACAGAAACAGAAAGG + Intergenic
1150258470 17:63769306-63769328 GCAAATGCACATAAAGAAAAAGG + Intronic
1150937247 17:69650361-69650383 GGAAATGCAAATCAAAACAACGG - Intergenic
1151087956 17:71402902-71402924 CTAAATTCACATAAACACCAAGG + Intergenic
1151798010 17:76359519-76359541 GGAAATGCTCATAAACAAAGTGG + Intronic
1152959438 18:70238-70260 AAAAATACACATTAACAAAATGG + Intronic
1153364546 18:4240188-4240210 AAAAATGCATATAAACACTGTGG - Intronic
1153740085 18:8115789-8115811 GAAAATGCACATGTACATCATGG - Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154407937 18:14113081-14113103 GCCAATGTACATATACACAAAGG - Intronic
1154507055 18:15052052-15052074 GAAAATGCATATAAACTGAGTGG - Intergenic
1155662375 18:28264773-28264795 GAAAATGTACATATACACCATGG - Intergenic
1155744058 18:29328741-29328763 AAAAATGAACAGAAATACAAAGG - Intergenic
1155796419 18:30043454-30043476 GGAAATGCAAATTAACACTACGG - Intergenic
1156292374 18:35759251-35759273 GAATATGTACCTATACACAATGG + Intergenic
1156515636 18:37677732-37677754 ATGCATGCACATAAACACAAAGG - Intergenic
1156682933 18:39613082-39613104 GAAAATACAAATAGACACACAGG + Intergenic
1156861342 18:41839729-41839751 TACAATGCACATAAACCCATAGG + Intergenic
1156941785 18:42776098-42776120 GGAAAAGGGCATAAACACAAAGG + Intronic
1156993372 18:43437465-43437487 GAAAATGTACATATATACAATGG - Intergenic
1157656387 18:49393434-49393456 TGAAATGTACATACACACAATGG + Intronic
1157670986 18:49528452-49528474 AAATATGCACATATACATAATGG - Intergenic
1158741521 18:60147809-60147831 TAAAATGTATATAAACTCAACGG + Intergenic
1158830095 18:61267375-61267397 GAAAATCCAAACAAACAAAATGG + Intergenic
1158842564 18:61403864-61403886 GAAAATGTACATATACACCATGG + Intronic
1159084109 18:63768457-63768479 GAAACTGCACATAAGCACTGTGG - Intronic
1159376045 18:67594841-67594863 GAAAATGTATATAGACACAATGG - Intergenic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1159674912 18:71270776-71270798 GGAAATGCAAATAAAAACCATGG + Intergenic
1160415773 18:78709674-78709696 GAAACTGCACACAAACCGAAAGG - Intergenic
1162807736 19:13147162-13147184 GAAAATGCAGATACACTCAGAGG + Intronic
1164225473 19:23241907-23241929 GAAAATGCACCCAAACAGGAAGG + Intronic
1164408778 19:27979109-27979131 GAAAAGGTACATGTACACAATGG + Intergenic
1164443192 19:28295212-28295234 GAAAATGTACTTATACACAATGG - Intergenic
1164718372 19:30410877-30410899 ACAAATGCATATAAATACAAAGG + Intronic
1165577563 19:36834446-36834468 GACAATGCACATTAAAACAAAGG + Intronic
1165883399 19:39059534-39059556 GAAAATGTACATATGCACAGTGG - Intergenic
1166598139 19:44069611-44069633 GGAAATGGACATATACACAATGG - Intergenic
1167879992 19:52449213-52449235 GAAAATGTATATATAGACAATGG - Intronic
1167900587 19:52618879-52618901 GAAAATGCAAAGATACACAAGGG + Intronic
1167923908 19:52807959-52807981 GAAAATACAAAGATACACAAGGG + Intronic
1167929079 19:52849035-52849057 GAAAATGCAAAAATACACAAGGG + Intronic
1167936757 19:52915144-52915166 GAAAATGCAAAGATCCACAAGGG + Intergenic
1167965656 19:53144084-53144106 GAGAAATCACTTAAACACAAAGG - Intronic
1167989451 19:53345667-53345689 GAAAATACAAAGATACACAAGGG - Intronic
1168001466 19:53449673-53449695 GAAAATACAAAGATACACAAGGG - Intronic
1168005893 19:53486793-53486815 GAAAATACAAAGATACACAAGGG - Intronic
1168321672 19:55513968-55513990 GAAAATACAAATTAAAACAATGG + Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925477046 2:4229180-4229202 GAAACTACACAAAATCACAATGG - Intergenic
926493284 2:13552487-13552509 GAAAATGCAAATATGCACAATGG + Intergenic
927400489 2:22704857-22704879 AATAATGCAGATAAATACAAAGG + Intergenic
927567929 2:24130171-24130193 GAAAATGTACATATACACCATGG - Intronic
927569808 2:24149086-24149108 GAAAATGCACTTACACGCAATGG - Intronic
927659203 2:24978430-24978452 AAAAATGTATATACACACAATGG - Intergenic
928777416 2:34782220-34782242 GAAAATGTATATATACACAATGG + Intergenic
928834172 2:35522999-35523021 GAAAAAGCTCAGAAACAAAAGGG + Intergenic
929153021 2:38764901-38764923 GAAAATCCACATAAAGAGTATGG + Intronic
929185678 2:39091537-39091559 AAAAATGAACTTAAACATAACGG + Intronic
929278501 2:40051845-40051867 GATAATGAACATAAAACCAACGG + Intergenic
929617943 2:43327079-43327101 AAAAATACACATAAAAACAGAGG + Intronic
929630048 2:43450495-43450517 GAATATACACAAACACACAAAGG + Intronic
930156827 2:48114552-48114574 AAGAAAGCACATAAACCCAAAGG + Intergenic
930555555 2:52891227-52891249 GAAATATCACATAAACAGAATGG - Intergenic
930638870 2:53835114-53835136 GAAAATGTGTATATACACAATGG + Intergenic
931029791 2:58160250-58160272 CATAATGCACTTAAAAACAAAGG - Intronic
931032498 2:58194988-58195010 GAAAATACACAAAAGCAGAAAGG + Intronic
931119986 2:59205711-59205733 GAAAATGCAAATATGCTCAATGG + Intergenic
931331629 2:61292008-61292030 GCAAATCCACAGAAACAGAAAGG + Intronic
931530048 2:63203912-63203934 GAAAATGTATATATGCACAATGG - Intronic
931684939 2:64784884-64784906 GAAAGTGCAAAGAAAAACAAAGG - Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932274342 2:70440816-70440838 GAAGTTGCACACAAAGACAAAGG - Intergenic
932453170 2:71828978-71829000 GAAAATGCATAGCAACCCAAAGG + Intergenic
932502567 2:72196756-72196778 GAAAATGAACTTAATGACAAAGG - Intronic
933306283 2:80603866-80603888 GAACATGCACATAAAAATATGGG + Intronic
933566503 2:83957061-83957083 GAAAAGGCACAGAAACCCCAGGG + Intergenic
933904881 2:86882084-86882106 GAAAATGTATATATACACCATGG + Intergenic
935121721 2:100188869-100188891 CAAAATGTGCATATACACAATGG - Intergenic
935309981 2:101773923-101773945 GAAAATGTACTTATACACAATGG - Intronic
935851797 2:107229721-107229743 GAAAATGTATATATACACCATGG - Intergenic
936367347 2:111870078-111870100 GAAAATGTATATATACACCATGG - Intronic
936383256 2:112006348-112006370 GAAAATGAACATAACTAAAAAGG + Intronic
937644925 2:124255775-124255797 GAAAATGCACACAATAATAAGGG - Intronic
937731376 2:125234796-125234818 GAAAATGTACATACACGCCATGG - Intergenic
938625334 2:133102786-133102808 CACACTGTACATAAACACAATGG + Intronic
939145252 2:138406155-138406177 GGAAATGCAAATCAAAACAATGG - Intergenic
939445933 2:142310272-142310294 GAAAATGCACAGGCACTCAATGG - Intergenic
939485070 2:142801391-142801413 GTGCATGCACATACACACAAAGG + Intergenic
939687651 2:145219280-145219302 GAAAATACAAGAAAACACAAAGG + Intergenic
940236648 2:151518204-151518226 GAAAATGCACAAAGATATAAGGG - Intronic
940521679 2:154758596-154758618 GAAAATACTCAGAAACAAAATGG - Intronic
940534380 2:154921231-154921253 CAAAAAGCACAAAAACATAAAGG + Intergenic
940587759 2:155675773-155675795 ATGAATACACATAAACACAAAGG + Intergenic
940675152 2:156718255-156718277 GAAAATGTACATATACACCATGG + Intergenic
940801040 2:158132795-158132817 GGAAATGCAAATTAAAACAATGG + Intronic
941221923 2:162792650-162792672 GAAGATTCAAATAAACGCAAAGG - Intronic
941590318 2:167411836-167411858 GAAAATGTATATATACAGAATGG + Intergenic
941799683 2:169644662-169644684 CAAAATTCACAGAAACAGAATGG + Intergenic
941934506 2:170972623-170972645 GAAAGAGCCCAGAAACACAATGG + Intergenic
942747364 2:179250297-179250319 GAAAATGCAAATTAAAACCACGG + Intronic
942813817 2:180027876-180027898 GAAAATGTACTTATATACAATGG - Intergenic
942845078 2:180414227-180414249 ATATATGCACACAAACACAATGG - Intergenic
943161102 2:184252412-184252434 GAAAATGTATTTATACACAATGG + Intergenic
943174381 2:184451171-184451193 AAAAATGCAGATAAGGACAAAGG - Intergenic
943200874 2:184822192-184822214 GAAAATGTACATATACACCATGG + Intronic
943399131 2:187383041-187383063 AAAACTGCACATATACAAAAAGG + Intronic
943801589 2:192066389-192066411 GAAATTACACTTAAACATAACGG + Intronic
944291285 2:198008566-198008588 GAAAATGTAAATATATACAATGG - Intronic
944947552 2:204707145-204707167 GAGAGTGCACAGAAACACACAGG - Intronic
945006151 2:205409285-205409307 GAGAAAGAACATAAACACAATGG + Intronic
945479647 2:210330003-210330025 GAAAATGTACATACACACCATGG - Intergenic
945560581 2:211334748-211334770 GAAAAGCACCATAAACACAAGGG + Intergenic
945569557 2:211448544-211448566 GCAAAGGCATATAAACACATGGG + Intronic
945621052 2:212137535-212137557 GAAAATGTACATATACACCATGG - Intronic
945760458 2:213907651-213907673 GAAAATGTATATATACACAATGG + Intronic
945838828 2:214864600-214864622 GAAAATGTACATATACGCAGTGG + Intergenic
946277060 2:218639494-218639516 GACAATTCATTTAAACACAACGG + Intronic
946697907 2:222379727-222379749 GATAAAGAACATATACACAATGG + Intergenic
947526984 2:230883820-230883842 TAAAATGCATATGAACAAAAAGG - Intergenic
948280236 2:236741195-236741217 GGAAATAGACAGAAACACAATGG - Intergenic
948501996 2:238402188-238402210 GAAAATACACATAATCAAAAAGG - Intergenic
948928908 2:241117920-241117942 GAAACTGGACATAAAAATAATGG + Intronic
1169244316 20:4014191-4014213 GAAAATTCACATCAAAGCAAGGG + Intronic
1169295740 20:4396330-4396352 GCAAATGTATATATACACAATGG - Intergenic
1169535640 20:6537003-6537025 GAACATACACAGAAAAACAAAGG - Intergenic
1170919939 20:20668533-20668555 AAAAATGCACATAAAAAACATGG + Intronic
1171946854 20:31386447-31386469 GAAAGTTTGCATAAACACAATGG + Intronic
1172402486 20:34661577-34661599 GAAAATGTACATATACACCATGG - Intronic
1172419432 20:34802762-34802784 CAAAATGCACATGAACTGAAAGG + Intronic
1172422278 20:34827473-34827495 TAAAATGTACATATACACAATGG - Intergenic
1172832789 20:37850384-37850406 GAAAATGGACACACACACACAGG - Intronic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173083892 20:39896363-39896385 GAAAATGTAAATAAGAACAACGG + Intergenic
1173458728 20:43224746-43224768 GAAAGTGCTCATAAATAAAAAGG - Intergenic
1173642261 20:44611980-44612002 GAAAATGTATATATACACAAAGG - Intronic
1173964715 20:47103425-47103447 GAAAATGGACTAATACACAATGG - Intronic
1175587651 20:60157617-60157639 GAAAATGTACATATACACCATGG + Intergenic
1175982846 20:62749053-62749075 TAAAATGGACTTAGACACAAGGG + Intronic
1176225048 20:63992584-63992606 GAAAATTCACAAAATCCCAAAGG - Intronic
1176790818 21:13317045-13317067 GAAAATGCATATAAACTGAGTGG + Intergenic
1177090671 21:16763551-16763573 GAAAATACACGTATGCACAATGG + Intergenic
1177230398 21:18312818-18312840 GAAAATACACATTAGCAAAAGGG - Intronic
1177877382 21:26650232-26650254 GAAAATGAACATAATGAAAATGG + Intergenic
1177925701 21:27211808-27211830 GAAAATGGACTAATACACAAGGG + Intergenic
1177990973 21:28036323-28036345 GAAAATGCATATAAACTGAGTGG - Intergenic
1178018903 21:28386415-28386437 GAAAATGCAAAGAAACATGAAGG - Intergenic
1178613920 21:34113546-34113568 GAGAAAGGACACAAACACAAAGG - Intronic
1179282114 21:39942625-39942647 GAAGATTCACACAGACACAAAGG - Intergenic
1182177807 22:28310746-28310768 GAAAATACAGATAAAATCAAAGG - Intronic
1182364749 22:29770980-29771002 GAAAATGGACTAATACACAAGGG + Intergenic
1182758784 22:32704425-32704447 GAAAATGTACATATACACCATGG - Intronic
1182976571 22:34627937-34627959 GAAAATCCAATTAAACACTATGG + Intergenic
1183097931 22:35565176-35565198 AAAAATGCACATGAACACACAGG + Intergenic
1183278137 22:36914197-36914219 GCACATGCACATACACACACAGG - Intronic
1183840504 22:40496434-40496456 GAAGATACAGATAAACAAAAGGG - Intronic
1183840526 22:40496753-40496775 GAAGATACAGATAAACAAAAGGG - Intronic
949120614 3:379380-379402 GAAAATGCTCAAATACCCAATGG - Intronic
949386861 3:3512524-3512546 GAAAATGTACATATACACCATGG + Intergenic
949403559 3:3690855-3690877 CAAAATGTACACAAAAACAAAGG - Intergenic
949698447 3:6727338-6727360 GAAAATGTATATATACACAATGG - Intergenic
949739993 3:7221175-7221197 AAAGATGCACATAACCTCAATGG - Intronic
950180167 3:10906443-10906465 GAAGATGAACATAAAGGCAAAGG + Intronic
950397051 3:12741653-12741675 TAAAATACACATAAACATAAAGG + Intronic
950892461 3:16416276-16416298 AATAATGCACATAAACAGAGTGG + Intronic
951096502 3:18638055-18638077 GAAAATGTACATATACACAATGG + Intergenic
951269863 3:20610861-20610883 GAAAATGTACCTATACACCATGG + Intergenic
951359572 3:21709167-21709189 GAAAATGGAAATAAACATTATGG - Intronic
951380242 3:21975193-21975215 GAAAATGTACATATACACAATGG + Intronic
951492320 3:23285239-23285261 GAAAATGGACACATACACAACGG - Intronic
951885618 3:27521108-27521130 TAAAATACACAGAAAGACAAAGG + Intergenic
952202441 3:31145220-31145242 GAAAATAAACAAAAAAACAATGG - Intergenic
952439324 3:33309711-33309733 GAAAAATCATATAATCACAAAGG - Intronic
952650320 3:35718920-35718942 AAAAATGCATATAGACATAAAGG + Intronic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953234426 3:41093789-41093811 GAAAATGTCCAAAGACACAAGGG + Intergenic
953298726 3:41750290-41750312 TAAAAGGCACAAAACCACAAGGG - Intronic
953682039 3:45046670-45046692 GGACATGGACATAAACACGAAGG - Intergenic
953714456 3:45305916-45305938 GAAAAGCCACATAAAGGCAATGG - Intergenic
954044247 3:47916028-47916050 GAAATTGCACAAACACAAAAAGG - Exonic
954277542 3:49552473-49552495 GAATATGCTCACAAACACTATGG - Intergenic
954769535 3:52953804-52953826 GAAAATACACAAAACCAAAAAGG + Intronic
955617534 3:60824975-60824997 GAAAATGCAAATGAAAATAATGG + Intronic
955683476 3:61526808-61526830 GAAAATACACATGAACCCACAGG + Intergenic
956350746 3:68333276-68333298 GAAAATGCAAATATACACCATGG + Intronic
956589596 3:70899757-70899779 GAAAATGTACATGGACAAAAAGG - Intergenic
957030603 3:75236235-75236257 GAAAATCCACAGACACTCAATGG + Intergenic
957380415 3:79421004-79421026 CAAAATGTACATATACACCATGG + Intronic
958159912 3:89805520-89805542 GAAAAGGCACATAAATTCAAAGG + Intergenic
958475865 3:94581191-94581213 CATAATGGACATAAACATAATGG + Intergenic
958671591 3:97212656-97212678 AAAAAAGCACATACACTCAAGGG - Intronic
958776541 3:98490001-98490023 GAAAATCCACACAAACACGTAGG + Intergenic
959245330 3:103861136-103861158 GAAAATGTATATATACACCATGG - Intergenic
959843898 3:111010513-111010535 GAAAATGCAGATAAAGAAAATGG + Intergenic
959956319 3:112242311-112242333 GAAAATATACATATACACAATGG + Intronic
960020725 3:112949078-112949100 GAAAATGCAAACAAAAATAATGG + Intronic
960033797 3:113082900-113082922 GAAAATGTACATATACACTATGG + Intergenic
960242955 3:115366857-115366879 GAAAATGTATATATACACCATGG + Intergenic
960415985 3:117385801-117385823 GAAAATGCACATTTACACAATGG + Intergenic
960603997 3:119486378-119486400 AAAAATGCACAAAAACCAAAGGG - Intronic
960791977 3:121442651-121442673 GAAAATGTACAGGTACACAATGG - Intronic
961175130 3:124829163-124829185 GAAAATGTAGATAAGCAGAAAGG - Intronic
961231511 3:125316208-125316230 GAAAATGTACATATGCACAATGG - Intronic
961334626 3:126164581-126164603 TAAAATGTACATATACACCATGG - Intronic
961532735 3:127549225-127549247 AAAAATGCACTTAAAGAAAAAGG + Intergenic
961927551 3:130497299-130497321 AAAAATGTATATATACACAATGG - Intergenic
962771285 3:138612502-138612524 TAAAATGCATATATATACAAAGG - Intronic
962814071 3:138982911-138982933 GCAAGTGCACATAATCACAGGGG - Intergenic
963377162 3:144482889-144482911 AAATATGCACATAGACACAAAGG + Intergenic
963421663 3:145068838-145068860 GGACATGCACATAAATAAAAGGG + Intergenic
963421892 3:145071898-145071920 CCACATTCACATAAACACAATGG - Intergenic
963455977 3:145548543-145548565 GAAAAATCACTTAACCACAAAGG - Intergenic
963553293 3:146752570-146752592 GAAGATCCAAATAAACACAATGG - Intergenic
963668587 3:148222548-148222570 GAAATTCCACATGAAGACAAAGG + Intergenic
963858676 3:150283666-150283688 GAAAATGTACATATACACAATGG + Intergenic
964208981 3:154207876-154207898 GAAAATGTACATATACACCATGG + Intronic
965101354 3:164302974-164302996 CAAAATGCAAATACATACAAAGG + Intergenic
965144015 3:164874818-164874840 AAAAATGCACATTAACTTAAAGG + Intergenic
965407131 3:168284277-168284299 GAAACTGTACATATACACATAGG - Intergenic
965712218 3:171566700-171566722 GAAAATGCAATTAAAAAGAAGGG + Intergenic
965726589 3:171723334-171723356 GAAAATGTACATACACATGATGG - Intronic
966308168 3:178561374-178561396 GTAAAAGCAAATAAACAAAATGG - Intronic
966517763 3:180837974-180837996 GAAAATGTACATATACACCATGG + Intronic
967116646 3:186347024-186347046 GAAAATGCAAACAAAAAGAAAGG - Intronic
967866002 3:194190362-194190384 GAAAATGTACATATACACCATGG - Intergenic
968011388 3:195280575-195280597 CAAAATGCAAATAAATACCAAGG + Intronic
968137645 3:196230486-196230508 GAAGACACACAGAAACACAAGGG - Intronic
968362810 3:198159715-198159737 AAAAATACACATTAACAAAATGG - Intergenic
968430120 4:552341-552363 AAAAATGCAAATAAAAACCAAGG - Intergenic
968727399 4:2254176-2254198 AAAAATGCAAATCAACAAAAAGG + Intronic
970044362 4:11833743-11833765 GAAAATGTACATATATACCATGG - Intergenic
970557635 4:17250828-17250850 GACTATGCACATAAAAACAGTGG + Intergenic
971364911 4:25969952-25969974 GAAAATACAGAAAAGCACAAAGG + Intergenic
971563120 4:28106583-28106605 GAATATACACAAAAACACACAGG + Intergenic
971729350 4:30357198-30357220 GAAAATGTACATATACACCATGG - Intergenic
972097525 4:35366820-35366842 AAAATTGCACATAAATACTAAGG - Intergenic
972193307 4:36621425-36621447 TTAAATGCCCATAAACAGAATGG + Intergenic
972438894 4:39065129-39065151 GAAAAAGAATATACACACAAAGG - Intronic
973064575 4:45772844-45772866 GAAAATGCACATATACCCCATGG - Intergenic
973263720 4:48189507-48189529 GAAAATGCAGAAATAGACAATGG + Intronic
974274163 4:59694502-59694524 GCCACTGCACATAGACACAAGGG - Intergenic
974697477 4:65395357-65395379 CTTATTGCACATAAACACAAAGG - Intronic
975046380 4:69808852-69808874 GAATATTCACATACACATAATGG + Intergenic
975059296 4:69978056-69978078 GAAAATGCAAGGAAATACAAAGG - Intergenic
975086297 4:70343854-70343876 GGAAATGCAGATATAGACAATGG + Intergenic
975167615 4:71195513-71195535 GAAAATTGAAATAAATACAAGGG + Intronic
975899285 4:79131409-79131431 AAAAATTAACAGAAACACAAAGG + Intergenic
975920616 4:79381787-79381809 GAAAATCAACATAGACACACTGG + Intergenic
976564912 4:86541925-86541947 GTAAATGCACATGAATACACCGG + Intronic
976900991 4:90175891-90175913 GAAAATGTATATAAACAAAATGG + Intronic
977051635 4:92135588-92135610 GGAAATGCAAATAAAAACTATGG + Intergenic
977325200 4:95565772-95565794 GAAAATGAATATATGCACAATGG - Intergenic
977367619 4:96090954-96090976 AAAAATGTATATATACACAATGG + Intergenic
977458308 4:97291952-97291974 AAAAATGTACATATACACAATGG - Intronic
977801181 4:101234104-101234126 GAAAATGTACATATACGCCATGG - Intronic
978062940 4:104360571-104360593 AAAAATGCTCAGAAACAGAAAGG + Intergenic
978066918 4:104416599-104416621 GTACATGCACAGAGACACAAAGG + Intergenic
978370635 4:108026631-108026653 GAAACTGGACAGTAACACAAAGG - Intronic
978509341 4:109499040-109499062 GAAAATGCAGATAAACAAAAGGG + Intronic
978547207 4:109883725-109883747 GAAAATGTACATATACATAACGG + Intergenic
979158089 4:117423531-117423553 GAAAATGTACATATACACAATGG - Intergenic
979479912 4:121204901-121204923 GAAAATACAAATTAAAACAATGG - Intronic
979506543 4:121503477-121503499 GAAAATGTATATATACACCATGG - Intergenic
979616902 4:122753115-122753137 AAAATTGTACATATACACAATGG + Intergenic
979726076 4:123963284-123963306 GAACATGTACAATAACACAAGGG - Intergenic
979914182 4:126409692-126409714 GAAGATTCAAATAAGCACAATGG + Intergenic
979964198 4:127057922-127057944 GAAAAACCACATAACCAGAAAGG + Intergenic
980272270 4:130600412-130600434 GAAAATACACAGACACACACAGG + Intergenic
980494623 4:133575199-133575221 GAAAATTCACGTGAACTCAACGG - Intergenic
980519493 4:133911925-133911947 GAAAATGTACATATAAACCATGG + Intergenic
980751868 4:137100891-137100913 GAAAATGTACATATACATCAAGG + Intergenic
981094810 4:140767839-140767861 GAAAATACAGATAAGCAAAATGG + Intergenic
981221680 4:142244270-142244292 AAAAAGGCACATATACACCATGG - Intronic
981310464 4:143293293-143293315 GAAAATGCACTTCTACACAAGGG + Intergenic
981467539 4:145091558-145091580 GAAAATGTACATATACACTATGG - Intronic
981499790 4:145437799-145437821 AAAAATGCATACAAACAAAAAGG + Intergenic
981506391 4:145504959-145504981 AAAAATGCATAAAAACACAAAGG - Intronic
981924394 4:150122386-150122408 GCAAATGCACATATACACCATGG + Intronic
981990177 4:150909482-150909504 GACAACACACATAAACACACGGG - Intronic
982195204 4:152904755-152904777 GAAAATGTACATATACACCATGG - Intronic
982632735 4:157852773-157852795 GAAAATGTACATATACACCATGG - Intergenic
982887445 4:160799137-160799159 GAAAATTCGAATTAACACAATGG - Intergenic
983063141 4:163180316-163180338 CAAAATTCACATACATACAATGG + Intergenic
983113856 4:163787496-163787518 GAAAATGCAAATCAAAACCACGG + Intronic
983128477 4:163984294-163984316 GAAAATGTACATATAAACAAAGG + Intronic
983432515 4:167669664-167669686 GAAAATGTATATATACACAGTGG - Intergenic
983450416 4:167903401-167903423 GAGAATGAACACAAACACATAGG - Intergenic
983820195 4:172183731-172183753 GAAGATATACAAAAACACAAGGG - Intronic
983892871 4:173048820-173048842 GAAAATCAACAAAAACACACAGG - Intergenic
983916091 4:173292955-173292977 AAAGATGGACATAAACAAAATGG - Intronic
983939786 4:173527131-173527153 GAAATTGCACATAAATAAACCGG + Exonic
984001321 4:174249850-174249872 GAAAATACAATTAAAGACAAAGG + Intronic
984380850 4:178990504-178990526 AAAATGCCACATAAACACAAAGG - Intergenic
984407448 4:179351339-179351361 CAAAATGGAAATTAACACAAAGG + Intergenic
984545225 4:181093501-181093523 GAAAAAACACATATACACTATGG - Intergenic
984693761 4:182758320-182758342 GGAAATGCACAAAAAGAAAAGGG + Intronic
984761889 4:183369564-183369586 GAAAATGCCAATTAACAAAAAGG - Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985236029 4:187875358-187875380 GAAAATGTACATATATACCATGG - Intergenic
985352473 4:189079885-189079907 GAAAATAAACATCCACACAAAGG + Intergenic
985857192 5:2438335-2438357 GTAAATGCACATAAAAATACAGG + Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986067778 5:4252360-4252382 GAAAATGAAAATAAACATAAAGG + Intergenic
986083745 5:4421439-4421461 GGGAAAACACATAAACACAAAGG - Intergenic
986159261 5:5210227-5210249 GAAAATGGACATAAAACTAATGG + Intronic
986296280 5:6441338-6441360 GAAAATGTACATATACACCAAGG - Intergenic
986634960 5:9812116-9812138 GACAATACAGATAAACATAATGG - Intergenic
987490515 5:18575280-18575302 GAAAATGTACATATACACCATGG + Intergenic
987612620 5:20226168-20226190 GTACATACACATAAACACACTGG + Intronic
987936490 5:24472348-24472370 AAAAATAAAGATAAACACAAAGG - Intergenic
987977041 5:25028030-25028052 GAAAAGGGATATAATCACAATGG + Intergenic
988090507 5:26533877-26533899 ATAAATGCAGATAAACACACAGG + Intergenic
988710280 5:33767069-33767091 CAAATTGCACATCTACACAATGG + Intronic
988800535 5:34692402-34692424 ATACATGCACATACACACAATGG + Intronic
988943724 5:36172971-36172993 TAAAATACAGAAAAACACAAAGG + Intronic
989244637 5:39240950-39240972 GAAAATGTACATATACACCATGG + Intronic
989297518 5:39847285-39847307 GAAAATATACATATACACCACGG - Intergenic
989340955 5:40375159-40375181 AAAAATGCACATAAATAGCACGG + Intergenic
989549434 5:42716473-42716495 GAAAGTGGCCATAAACAAAATGG + Intronic
989610353 5:43284901-43284923 GAAAATGTATATAAACACAATGG - Intergenic
989693932 5:44177015-44177037 GAAAATGTATATATACACCATGG - Intergenic
990215381 5:53526020-53526042 GAAAATGTACATGTACACCATGG - Intergenic
991228243 5:64298224-64298246 GAAAATGTACATTTACACCATGG - Intronic
991454408 5:66787057-66787079 GAAAATGCAAATATATACAAAGG - Intronic
992127293 5:73654788-73654810 GAAAATGATCAGACACACAAGGG - Intronic
992954965 5:81898964-81898986 GAAAATGCATATATACACTATGG + Intergenic
993149651 5:84144464-84144486 GAAAATGCACAGACTCTCAAAGG + Intronic
993221390 5:85101931-85101953 GAAAATGTACATATACACCATGG + Intergenic
993483975 5:88459481-88459503 TAAAATGCAGAGAAGCACAAAGG - Intergenic
993484324 5:88463686-88463708 GAAAATGTATATATACACCATGG - Intergenic
993512290 5:88786115-88786137 AAAAAAGCACACACACACAAAGG + Intronic
993794981 5:92255808-92255830 AAAAATGCACATATACACCATGG - Intergenic
993888877 5:93448419-93448441 TGAAATGCACACAAAGACAATGG + Intergenic
994036478 5:95207652-95207674 GTAAACACACATAAATACAAAGG + Intronic
994351184 5:98748407-98748429 GAAAATGTACATATACACCATGG + Intergenic
994472559 5:100226767-100226789 AAAAATGTACATATACACCATGG - Intergenic
995078362 5:108015204-108015226 TAAGATGAACATAAAAACAAGGG + Intronic
995154046 5:108889330-108889352 GGAAATGTACCTATACACAATGG + Intronic
995562532 5:113398461-113398483 GAAAATGCACATATATACCATGG + Intronic
995598335 5:113770747-113770769 TAAAATGATCATAAACACATAGG + Intergenic
995605459 5:113849721-113849743 TCAAATGCACAGAAAGACAAAGG - Intergenic
995789742 5:115872614-115872636 GAAAGTGAACATATACCCAAGGG - Intronic
996050899 5:118932103-118932125 TAAAATGCACATTAAGAAAAAGG + Intronic
996060964 5:119032925-119032947 GACAATGAACAGAAACACAGAGG + Intergenic
996544512 5:124663538-124663560 GAAAAAGCACAAAAACCAAATGG + Intronic
996951419 5:129130677-129130699 GAAAATGCAAGTAAAAAAAACGG - Intergenic
997750823 5:136344058-136344080 GAAAATGTACATAAATACCATGG + Intronic
997785993 5:136714512-136714534 GAAAATGTACATATACACCATGG - Intergenic
997803945 5:136894936-136894958 GAAATTTAAAATAAACACAAAGG - Intergenic
999156662 5:149462858-149462880 GAAAATGCTCAATAACACTAGGG - Intergenic
999383445 5:151137884-151137906 GAGAATGGACTAAAACACAAAGG + Intronic
1000514424 5:162222373-162222395 GAACATGCACAAAAACCCTACGG + Intergenic
1000778933 5:165455173-165455195 AAAAATGCAAATTAAAACAATGG - Intergenic
1000913783 5:167054746-167054768 GAAATTGCAAATTAAAACAATGG - Intergenic
1001324978 5:170716937-170716959 TAAAATGCAAATAAAGAAAATGG - Intronic
1001346927 5:170911453-170911475 GAAAATGATCATAAACAGAGTGG - Intronic
1001874848 5:175191024-175191046 TAAAATGCACATAATCATATGGG - Intergenic
1001971449 5:175958014-175958036 GAAAATGCACTCAAACCAAAGGG + Intronic
1001976068 5:175999888-175999910 GAAAATGCACATCTATACAAAGG + Intronic
1002241355 5:177843883-177843905 GAAAATGCACATCTATACAAAGG - Intergenic
1002245995 5:177885763-177885785 GAAAATGCACTCAAACCAAAGGG - Intergenic
1002945335 6:1756175-1756197 AAAAATACACATATAAACAAAGG + Intronic
1003258941 6:4498558-4498580 CAAAATGAACAGAAAAACAAAGG + Intergenic
1003742431 6:8957060-8957082 AAAAATTAACAAAAACACAAGGG + Intergenic
1003985040 6:11427038-11427060 GAAAATCCACAAAGACACCAAGG + Intergenic
1004624331 6:17360630-17360652 GAAAATGTACATATACATCACGG + Intergenic
1004727325 6:18323816-18323838 TAAAATGCACAGAACCACCAAGG - Intergenic
1004772125 6:18795870-18795892 GAAAATGCACTTACCCGCAAGGG + Intergenic
1005058573 6:21754860-21754882 GCAAATGCAAATAAAGACAAAGG + Intergenic
1005086452 6:22012251-22012273 GAAATTTCACAGCAACACAATGG + Intergenic
1005773772 6:29106122-29106144 GAAAATTCACATATACAACATGG - Intergenic
1005853523 6:29841540-29841562 TAAAATACACATAAACACAAAGG + Intergenic
1005909704 6:30297745-30297767 GAAAATGTACATATACACCGTGG - Intergenic
1006018282 6:31100465-31100487 GAAAATGTACATATACATAATGG - Intergenic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1006484006 6:34322882-34322904 GAAAGTGTACATATACAAAATGG + Intronic
1007362076 6:41365915-41365937 GAAAATGTACATATACACAATGG - Intergenic
1008083571 6:47220304-47220326 GAAAATGCATATATAGACAATGG + Intergenic
1008313712 6:50012112-50012134 CAAAAGGCAAATAAAGACAAAGG - Intronic
1008431173 6:51419058-51419080 GAAAATGTATATACACACTATGG - Intergenic
1008596980 6:53052260-53052282 GAAAATGTACATATACACCATGG - Intronic
1008724679 6:54402241-54402263 AACAATGCACATATACACCATGG - Intergenic
1009198719 6:60718916-60718938 GAAAAAAAACATAAACATAATGG - Intergenic
1009492533 6:64310362-64310384 GAAAATGTACATAGACACAATGG + Intronic
1009528085 6:64773339-64773361 GAAAATGTACATATATACCATGG - Intronic
1009567096 6:65323133-65323155 GAAAATGTAGAAAAGCACAAAGG + Intronic
1009831592 6:68943856-68943878 GTAAATGAACATAAACTCCATGG - Exonic
1010138097 6:72578825-72578847 GAAAATGCATTTAAAAAGAAAGG + Intergenic
1010320799 6:74507066-74507088 GAAAAATCACTTAACCACAAAGG + Intergenic
1010477331 6:76304095-76304117 GAAAATGTACATATACACCATGG - Intergenic
1010986574 6:82432129-82432151 GAAAATGTACATAAACTGATTGG - Intergenic
1011396249 6:86911926-86911948 GAAAATGTACATACACACCATGG + Intergenic
1011411447 6:87070757-87070779 GGAAAAGGACATAAAAACAAGGG - Intergenic
1011543105 6:88454598-88454620 GAAAATGCACCTGAACAAAAGGG + Intergenic
1011900392 6:92287519-92287541 GAAAATGTACATATACACGATGG - Intergenic
1011994941 6:93574607-93574629 GAAACTGCACATAAAGGAAATGG - Intergenic
1012355123 6:98304730-98304752 GAAAAATCACATAAAGATAATGG - Intergenic
1012637006 6:101555804-101555826 GTAAATGCAAATAAAAACATAGG + Intronic
1012852293 6:104461945-104461967 GAACATAAACATACACACAAAGG - Intergenic
1013687790 6:112605621-112605643 GACAATGTACATATACACAATGG + Intergenic
1013700552 6:112764442-112764464 GAAAATAAAGATAAATACAAAGG - Intergenic
1013808779 6:114021110-114021132 GAAAATGTACGTATACACAATGG + Intergenic
1014486075 6:122000830-122000852 GACATTGCACATAAACAGAGAGG - Intergenic
1014821586 6:125994735-125994757 GAAAATGTACATATACACCATGG + Intronic
1015109632 6:129577045-129577067 AAAAATACTCATAAACACATAGG + Exonic
1015160679 6:130149494-130149516 GAAAATGTACATGTACACCATGG + Intronic
1016089746 6:139962349-139962371 GAGAATGCAGAGAAACACAAAGG + Intergenic
1016249949 6:142028758-142028780 GAAAATGTATATATACACCATGG - Intergenic
1016601978 6:145872816-145872838 GAAAATGTACATATACAACATGG + Intronic
1016649764 6:146449843-146449865 CAAAATGCCCAGGAACACAAAGG + Intergenic
1017849494 6:158292415-158292437 GCACATACACATAAACATAAGGG - Intronic
1017886660 6:158605723-158605745 GAAAATGCCCAAAAACGCAAAGG - Intronic
1019252873 7:28996-29018 AAAAATACACATTAACAAAATGG + Intergenic
1019887885 7:3921105-3921127 GAAAATACAGAGAAACAGAAAGG + Intronic
1020419040 7:7979477-7979499 AAAAATACACATAAACAGAGTGG - Intronic
1020523951 7:9233588-9233610 GAACACACACATAAACACAAGGG + Intergenic
1020528317 7:9294406-9294428 GAAAATGCACATAAAGCCCTTGG - Intergenic
1020716907 7:11685997-11686019 GAAAATGTACATATACACCATGG + Intronic
1020801497 7:12738266-12738288 GAAAATACAAATAAGCATAATGG - Intergenic
1020808738 7:12825079-12825101 GAAAATGTACATATACACCATGG + Intergenic
1021236692 7:18151177-18151199 GAAAATCTATATAAAAACAAGGG - Intronic
1021412174 7:20341178-20341200 CCAAATGCACAAAAACACAATGG - Intronic
1021608920 7:22437462-22437484 GAAAATGTATATACCCACAATGG - Intronic
1022420276 7:30214288-30214310 ATAAATGCACACACACACAATGG - Intergenic
1022984865 7:35642588-35642610 GAAAAAGTACATATACACCATGG + Intronic
1023468622 7:40488157-40488179 AAAAATTCAAATAACCACAAAGG - Intronic
1023518819 7:41030454-41030476 GAAAATACACATAAAGAGGATGG + Intergenic
1023596921 7:41839360-41839382 GAAAATGCAAAGTAAAACAAGGG - Intergenic
1023747679 7:43336906-43336928 GAAAATGTATATATACACCATGG - Intronic
1024310089 7:47961213-47961235 CAAAATGGACATATACACAATGG + Intronic
1024316391 7:48022048-48022070 GAAAATGTACATATTCACAATGG + Intronic
1024816151 7:53274535-53274557 GAAAACCCACACAAACACATTGG + Intergenic
1025061098 7:55809043-55809065 GAAAATGAACATATACACTATGG + Intronic
1025524608 7:61788994-61789016 CAAAATGTCCATTAACACAATGG + Intergenic
1025784256 7:64630084-64630106 GAAAATGTACATATACACCATGG + Intergenic
1028092002 7:86714391-86714413 GAAAATGCACATACAGTAAAAGG - Intronic
1028111321 7:86946125-86946147 GGAAATGCAAATTAAAACAAAGG + Intronic
1028302450 7:89217626-89217648 GAACATGGACATAAACCCATTGG + Intronic
1028364197 7:90008093-90008115 GCACATGTACATAAATACAAAGG + Intergenic
1028932995 7:96434655-96434677 GAAAATGCAAATCAAAACCACGG - Intergenic
1030377274 7:108768108-108768130 GAAATTGCACATAAACATTTTGG + Intergenic
1030401511 7:109057439-109057461 GAAAATGTATATATACACCATGG - Intergenic
1030722803 7:112889500-112889522 GAGAATACACACACACACAATGG + Intronic
1030865624 7:114698695-114698717 CAAAATGCAATTTAACACAAAGG - Intergenic
1031244134 7:119285301-119285323 AAAAATAAAAATAAACACAAGGG - Intergenic
1031258239 7:119483586-119483608 GAAAATGTATATATACACCATGG - Intergenic
1032733237 7:134665247-134665269 CAAAGTGCACATATACACCATGG + Intronic
1032830049 7:135613948-135613970 GAAAATACACTGAAATACAATGG - Intronic
1032965781 7:137095298-137095320 AAAAATACACTTAAACACATAGG + Intergenic
1033027042 7:137784573-137784595 GAAAATGAACAAAGAAACAATGG + Intronic
1033107268 7:138538835-138538857 AAAAATGCACAGTAAAACAATGG + Intronic
1033481180 7:141742562-141742584 GAAAATCTTTATAAACACAAGGG - Intronic
1033814564 7:145056191-145056213 GCAAAAGCACAGAAACATAAAGG + Intergenic
1033828755 7:145226122-145226144 GAAAATGCAGATAAAAAATATGG + Intergenic
1034173746 7:149083892-149083914 GAAAATGTACATATGCACTATGG - Intronic
1034381473 7:150698399-150698421 GAAAATGTACATATACACTATGG + Intergenic
1034861893 7:154603119-154603141 GAAAAGAAACATATACACAAAGG - Intronic
1035255735 7:157625885-157625907 GAAAATGAAGATAAGCAGAATGG + Intronic
1036017211 8:4798369-4798391 AAAAATGCACATATACACCATGG - Intronic
1036055278 8:5245359-5245381 AAAAATACAAATAAACACAAGGG + Intergenic
1036075928 8:5499588-5499610 GAAAATACACATATATACCATGG - Intergenic
1036103607 8:5815290-5815312 GAAAATGTACATATATACCATGG + Intergenic
1036189393 8:6656546-6656568 GAAAAGAAAAATAAACACAATGG + Intergenic
1037435024 8:18853398-18853420 GAAAATGGACATAATATCAACGG + Intronic
1037467809 8:19177043-19177065 TAAAATGCTCAGAAACAGAAGGG + Intergenic
1037929071 8:22866688-22866710 TAAAATACATATAAACACACAGG + Intronic
1038254471 8:25938340-25938362 GAAAAATAACATTAACACAAAGG - Intronic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1038674553 8:29612115-29612137 GAAAATGCAGATCAGCAAAAAGG + Intergenic
1039732550 8:40295278-40295300 GAAGAAACACAAAAACACAAAGG + Intergenic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1040425932 8:47286373-47286395 GTAAATTCACCTAAACATAAAGG + Intronic
1040449891 8:47534411-47534433 GAAAATGTACATATACACCATGG + Intronic
1040541275 8:48358690-48358712 GAAGATCTACATAAACAGAAAGG + Intergenic
1040673392 8:49718953-49718975 TCAAATGCACATAAACTAAAGGG + Intergenic
1040681355 8:49813618-49813640 TAAAATACACATACACACACAGG - Intergenic
1040912742 8:52537603-52537625 GAAAATGTGTATATACACAACGG + Intronic
1041172417 8:55157884-55157906 GAAAATGTACATAGACACCATGG - Intronic
1041296765 8:56364778-56364800 GAGAATGTATATATACACAATGG + Intergenic
1041610801 8:59845839-59845861 GAAAATGTACCTATACACCATGG + Intergenic
1042330514 8:67575512-67575534 GAAAATGTATATATACACAATGG + Intronic
1042500748 8:69506283-69506305 TAAAATGCAACTAAACAGAATGG - Intronic
1042532982 8:69833552-69833574 GAAAATGCCCAAAAGAACAAAGG + Intronic
1043213522 8:77554700-77554722 GAAAAATCACTTAACCACAAAGG + Intergenic
1043397541 8:79853605-79853627 GAATATGGACATAAACACAGAGG - Intergenic
1043825654 8:84925654-84925676 GAAAATGATGATAAACACAAAGG + Intergenic
1043945441 8:86246168-86246190 GAAAATGTACATATACACAAGGG - Intronic
1043975111 8:86576006-86576028 GAAAATGAAGATAAAGATAAAGG - Exonic
1044826435 8:96202675-96202697 GAAAATATACATATACACGATGG - Intergenic
1045337275 8:101218172-101218194 ACAAATACACATAAACACAAAGG + Intergenic
1045403895 8:101846036-101846058 GAAAATGTATATATACACAATGG - Intronic
1046072337 8:109272080-109272102 GAAAATGTCAATCAACACAAAGG + Intronic
1046150482 8:110217792-110217814 GAAAATGTACCTATGCACAATGG + Intergenic
1046202457 8:110945170-110945192 GAAAATGTATATATACACCATGG - Intergenic
1046408588 8:113808989-113809011 CAAACTCCACATAAACACAATGG - Intergenic
1046838709 8:118832257-118832279 GAAAATGTACATATACACCATGG + Intergenic
1046886157 8:119369510-119369532 GAAAATGTACATATACACCATGG + Intergenic
1047112903 8:121810891-121810913 GAAAATAAACTTCAACACAATGG - Intergenic
1048142342 8:131806719-131806741 GAAAAAGCATAAAAATACAAGGG - Intergenic
1048232104 8:132652574-132652596 CAAAATTCACATATACACCATGG + Intronic
1048417721 8:134245011-134245033 GAAAATGTACATATACACCATGG - Intergenic
1048724491 8:137367051-137367073 GAGACTGAACAAAAACACAAAGG - Intergenic
1048761410 8:137799475-137799497 GAAAATGTACATATACACCACGG - Intergenic
1048783649 8:138027804-138027826 GAAAATGCTCATAAACAGAGTGG + Intergenic
1050045708 9:1542675-1542697 GAAAATGTACATATACATCATGG - Intergenic
1050109336 9:2198745-2198767 TAAAATGATAATAAACACAATGG + Intergenic
1050552981 9:6763588-6763610 GAAAATGCACATAAACACAAAGG - Intronic
1050761435 9:9076659-9076681 GAAAATGTACATTCACACAGTGG - Intronic
1050842962 9:10176072-10176094 GAAAATGGTCATAAAAGCAAAGG + Intronic
1050845403 9:10210937-10210959 TAAAATTCACCTATACACAATGG + Intronic
1051534907 9:18146007-18146029 GAAAATGCAAATTAAAACCAAGG + Intergenic
1051664149 9:19452540-19452562 GAAAATGCAAATTAACAAATTGG + Intergenic
1051852461 9:21525544-21525566 GAAAATGTACATATACACCATGG - Intergenic
1052089296 9:24307783-24307805 GAAAATGTACATAAACTCAATGG + Intergenic
1052177227 9:25477132-25477154 GACAATGCAGAAAAAAACAAAGG + Intergenic
1052636815 9:31117059-31117081 GAAAATGTACATATACACCATGG - Intergenic
1052694714 9:31862686-31862708 GAAAATGTATATAAACACAATGG - Intergenic
1052768934 9:32669856-32669878 GAAAATGTACATACACACCATGG + Intergenic
1053118534 9:35527029-35527051 GAAACAGCACAAAAAAACAAAGG - Intronic
1053175121 9:35917041-35917063 AGAAATTCAGATAAACACAAAGG - Intergenic
1053558417 9:39162598-39162620 GAAAATGTACATATATACCATGG + Intronic
1053822532 9:41982823-41982845 GAAAATGTACATATATACCATGG + Intronic
1054138697 9:61456344-61456366 GAAAATGTACATATATACCATGG - Intergenic
1054608044 9:67204543-67204565 GAAAATGTACATATATACCATGG - Intergenic
1054719158 9:68586205-68586227 GAAAATACAGATAAACCAAATGG - Intergenic
1055387619 9:75780282-75780304 GAAAATGTACATATACACAATGG + Intergenic
1055540210 9:77296363-77296385 GAAATAGCACAGAAACACAGAGG - Intronic
1056009045 9:82306206-82306228 GAAAATGAAGATAAACAGCAGGG - Intergenic
1056295189 9:85185891-85185913 GAGAAAGCACATAAAAGCAAGGG + Intergenic
1056510466 9:87299834-87299856 AAAAATGTATATATACACAATGG - Intergenic
1056562680 9:87746134-87746156 GAAAATATACATATACACAATGG - Intergenic
1056648442 9:88435888-88435910 GAAAAGCAACATAAACACATAGG - Intronic
1057338490 9:94177490-94177512 TAAACTGCACATAAAAACATGGG + Intergenic
1057492845 9:95535733-95535755 GAAAATGTAAATAAAAACCACGG + Intergenic
1057644700 9:96862040-96862062 GAAAATGTACATATACACAATGG + Intronic
1057756402 9:97841020-97841042 AAAAATTCATATAGACACAAGGG + Intergenic
1057949797 9:99360615-99360637 CAAAATGCCCATAAACTGAATGG + Intergenic
1058000341 9:99858408-99858430 CAAAATGCACAGAAATCCAACGG + Intronic
1058516883 9:105785050-105785072 GAAAATGTACATATACACCATGG - Intergenic
1058580191 9:106447458-106447480 GAAAAAGCAAAAAAACAAAAAGG + Intergenic
1058611480 9:106780969-106780991 CAAATTGCAAATAAACACTATGG + Intergenic
1059573945 9:115470023-115470045 GAAAATGCAGAGAAAGACAAAGG - Intergenic
1059701542 9:116779684-116779706 GAAAATGAACAGAAAAAGAAGGG - Intronic
1060313171 9:122482641-122482663 GAAAATGTATATATACACAATGG + Intergenic
1060570239 9:124632029-124632051 GAAAATGTACATATACATCATGG - Intronic
1061323267 9:129845781-129845803 GAAAATGCAGAAAAGCAAAAAGG + Intronic
1061738767 9:132683487-132683509 GAAAAAGCCTACAAACACAAAGG - Intronic
1062157282 9:135059746-135059768 GAAAAAGCACAAAAACAAAGTGG + Intergenic
1062747497 9:138223378-138223400 AAAAATACACATTAACAAAATGG - Intergenic
1203350332 Un_KI270442v1:76348-76370 GAAAATGGAATTGAACACAATGG + Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1185939425 X:4298870-4298892 GAAAATGTGCATATCCACAACGG + Intergenic
1186983423 X:14984269-14984291 GAAAATGTACCTATACACAATGG + Intergenic
1187111087 X:16301420-16301442 GAAAATGCAGTTAAAAACAGAGG - Intergenic
1187144294 X:16623619-16623641 GAAAATGTACTTATACACAATGG - Intronic
1187466884 X:19535401-19535423 TAAAATGCAAATGAAAACAAGGG - Exonic
1187512054 X:19928706-19928728 GAAAATGCATATATATACAATGG + Intronic
1187587353 X:20678416-20678438 GAAAATGCCATAAAACACAAAGG - Intergenic
1187653645 X:21442782-21442804 GAAAATGTATATATACACCATGG + Intronic
1187756407 X:22531961-22531983 GAAAATGTACATATACACTGTGG + Intergenic
1188090994 X:25965303-25965325 GAAAATGCATACAAGCACTATGG - Intergenic
1188287263 X:28343012-28343034 GAAAATGTACATATACACAACGG - Intergenic
1188289500 X:28370022-28370044 GAAAATGTACATACACACCACGG - Intergenic
1188295897 X:28447903-28447925 GAAAATGTACATATACACCATGG + Intergenic
1188296248 X:28453114-28453136 GCAAATGCAGATATACAAAAAGG - Intergenic
1188411577 X:29878385-29878407 TAAAATGCATATAAACCCAAAGG - Intronic
1188707008 X:33347121-33347143 GAAAATGTATATATACACCATGG + Intergenic
1188809722 X:34638335-34638357 GAAAATGAACACAAACAGTAGGG + Intronic
1189132040 X:38509695-38509717 GAAAATGTACATATACACCATGG + Intronic
1189237603 X:39499762-39499784 GAAAATGTACATATACACCATGG - Intergenic
1189612281 X:42750138-42750160 GTAAATGTACTTATACACAATGG + Intergenic
1189699010 X:43696825-43696847 GGCCATGCACATCAACACAATGG + Intronic
1189825014 X:44909205-44909227 GCAAATGCAGCCAAACACAAGGG - Intronic
1189842613 X:45096991-45097013 GAAAATGTATATATACACCATGG + Intronic
1190244732 X:48683747-48683769 GGAAATGCAAAAAACCACAAGGG - Intronic
1190398947 X:50012472-50012494 GTACATACACACAAACACAATGG + Intronic
1191189015 X:57645978-57646000 GAAAATGTACATATACACATTGG + Intergenic
1191227272 X:58056393-58056415 AAAAATACACAGAAAGACAAAGG - Intergenic
1191819662 X:65290634-65290656 GAAAATATACATATACACAATGG + Intergenic
1191878688 X:65822726-65822748 GAAAATGTACATATAAACCATGG + Intergenic
1191959188 X:66680810-66680832 AAATATGTACATAAACACCATGG - Intergenic
1191976018 X:66872348-66872370 GAAAATGTACTTAAATACAATGG - Intergenic
1192688896 X:73338294-73338316 GAAAATGTACATATACACAATGG + Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1192932488 X:75822511-75822533 AAAAAGGCACATAGACACACAGG + Intergenic
1192975568 X:76280498-76280520 GAAAATGTACATATACACAACGG - Intergenic
1192990604 X:76451392-76451414 GAAGATGCAAATAAACAGAAAGG - Intergenic
1193335817 X:80287477-80287499 GAAAAAACACATAAATACAGTGG + Intergenic
1193336916 X:80300716-80300738 GAAAATTTACGTATACACAATGG - Intergenic
1193371054 X:80697679-80697701 GAAAATGTACATAGACATCATGG - Intronic
1193378027 X:80784747-80784769 GAAAAGGTACATATACACCATGG - Intronic
1193504740 X:82328489-82328511 GAAAATATACATATACACCATGG + Intergenic
1193617130 X:83702847-83702869 GAAGATCCAAATAAACATAATGG - Intergenic
1193630859 X:83886513-83886535 AAAAATGCAAATAAAAAGAAAGG - Intronic
1193638220 X:83979426-83979448 GAAAATGTATATATACACCATGG + Intergenic
1193826491 X:86232971-86232993 GAAAATGTACATATACACCATGG + Intronic
1193891237 X:87048389-87048411 GAAAATGTACTTATACACAATGG - Intergenic
1193920236 X:87415931-87415953 GAAAATGTACATATACATCATGG - Intergenic
1193979530 X:88164793-88164815 GTTAGTGCACATGAACACAAAGG - Intergenic
1194137664 X:90166628-90166650 GAAAATGTACATATACACGATGG + Intergenic
1194391293 X:93321096-93321118 GAAAATGTACATATACACAATGG - Intergenic
1194575172 X:95604135-95604157 GAACATGTACATAAACACAATGG + Intergenic
1194935456 X:99942222-99942244 GAAAATGCAGACAAGCAAAAAGG - Intergenic
1195083588 X:101393142-101393164 GAAAATGCACCTATACACAGTGG + Intronic
1195279777 X:103320232-103320254 GAAAGTGTACGTATACACAATGG - Intergenic
1195414946 X:104610046-104610068 TAAAATCAACATCAACACAAAGG - Intronic
1195484079 X:105382752-105382774 AAATGTGCACATAAACACCATGG + Intronic
1195828948 X:109034057-109034079 GAAAAATCACTTAACCACAACGG + Intergenic
1196008519 X:110861380-110861402 GAAAATGTATATATACAAAATGG + Intergenic
1196256200 X:113521983-113522005 GAAAATGTACATATATGCAATGG - Intergenic
1196357133 X:114808328-114808350 GAAAATGTACACATACACAATGG - Intronic
1197465220 X:126797026-126797048 GAAATTTCCCATAAATACAAGGG + Intergenic
1197525112 X:127551642-127551664 GAAAATGCATATATACACAAAGG - Intergenic
1197564891 X:128070830-128070852 GAAAATGTAGATATACACCATGG - Intergenic
1197568374 X:128117028-128117050 GAAAATGAACTAATACACAAAGG + Intergenic
1197950081 X:131885254-131885276 GAAAATACACATGTACACCATGG - Intergenic
1198243204 X:134804708-134804730 GAAAATTAAAATGAACACAATGG + Intronic
1198501535 X:137254120-137254142 GAAAATGTACATACACAAGACGG + Intergenic
1198882620 X:141297528-141297550 TAAAATGTGCATAGACACAATGG + Intergenic
1199099146 X:143778745-143778767 GAAAATGTACATATACACAATGG + Intergenic
1199304636 X:146252947-146252969 GAAAATGTATATATACACAATGG + Intergenic
1199328150 X:146526041-146526063 GAAAATGCTTATAAACAAAGTGG - Intergenic
1200354013 X:155528692-155528714 GAAAATGTATATATACACCATGG - Intronic
1200483450 Y:3736896-3736918 GAAAATGTACATATACACGATGG + Intergenic
1200886669 Y:8278755-8278777 AAAAATGCACATGAGAACAATGG + Intergenic
1200985441 Y:9298274-9298296 GGAAATGTCTATAAACACAATGG + Intergenic
1201349621 Y:13024956-13024978 CAAAAATCACCTAAACACAAAGG - Intergenic
1201704609 Y:16922362-16922384 GAAAATGTACATATACACCCTGG - Intergenic
1201722719 Y:17119172-17119194 GAAAATACACCTATCCACAATGG + Intergenic
1202108798 Y:21399921-21399943 AAAAGTGCACATAAAAACAATGG + Intergenic
1202111908 Y:21429517-21429539 AATAGGGCACATAAACACAATGG + Intergenic