ID: 1050552984

View in Genome Browser
Species Human (GRCh38)
Location 9:6763630-6763652
Sequence CAGTGTTACCATTGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050552981_1050552984 19 Left 1050552981 9:6763588-6763610 CCTTTGTGTTTATGTGCATTTTC 0: 1
1: 1
2: 32
3: 212
4: 736
Right 1050552984 9:6763630-6763652 CAGTGTTACCATTGTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050552984 Original CRISPR CAGTGTTACCATTGTGAAGA GGG Intronic
No off target data available for this crispr