ID: 1050553720

View in Genome Browser
Species Human (GRCh38)
Location 9:6771235-6771257
Sequence TGTGAATCTTTAGGAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050553711_1050553720 25 Left 1050553711 9:6771187-6771209 CCCCAAAGTGCTAGGATTACAGG 0: 303
1: 4366
2: 5536
3: 4389
4: 4741
Right 1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG No data
1050553709_1050553720 27 Left 1050553709 9:6771185-6771207 CCCCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG No data
1050553710_1050553720 26 Left 1050553710 9:6771186-6771208 CCCCCAAAGTGCTAGGATTACAG 0: 314
1: 4205
2: 6378
3: 5490
4: 5949
Right 1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG No data
1050553714_1050553720 23 Left 1050553714 9:6771189-6771211 CCAAAGTGCTAGGATTACAGGTG 0: 6033
1: 84644
2: 218857
3: 252033
4: 196794
Right 1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG No data
1050553716_1050553720 -4 Left 1050553716 9:6771216-6771238 CCACTGCACCTGGCCTGATTGTG 0: 1
1: 25
2: 257
3: 1604
4: 7040
Right 1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG No data
1050553708_1050553720 30 Left 1050553708 9:6771182-6771204 CCTCCCCCCAAAGTGCTAGGATT 0: 2
1: 349
2: 4359
3: 3880
4: 2861
Right 1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG No data
1050553713_1050553720 24 Left 1050553713 9:6771188-6771210 CCCAAAGTGCTAGGATTACAGGT 0: 6328
1: 96058
2: 316692
3: 235985
4: 141398
Right 1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050553720 Original CRISPR TGTGAATCTTTAGGAATAAT TGG Intronic
No off target data available for this crispr