ID: 1050556389

View in Genome Browser
Species Human (GRCh38)
Location 9:6792976-6792998
Sequence TGCCCTAACCATCATGGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050556384_1050556389 1 Left 1050556384 9:6792952-6792974 CCCTACTGTCTTCTCTCCAGACA 0: 1
1: 2
2: 6
3: 98
4: 783
Right 1050556389 9:6792976-6792998 TGCCCTAACCATCATGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 247
1050556385_1050556389 0 Left 1050556385 9:6792953-6792975 CCTACTGTCTTCTCTCCAGACAC 0: 1
1: 0
2: 14
3: 52
4: 444
Right 1050556389 9:6792976-6792998 TGCCCTAACCATCATGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050556389 Original CRISPR TGCCCTAACCATCATGGAGG TGG Exonic
900413251 1:2523233-2523255 TGCCCTCACCACCAGGCAGGAGG - Intronic
901903766 1:12390623-12390645 TGCCCTTTCCATGATGGAAGAGG + Intronic
905354225 1:37369835-37369857 TGCCCTTTCCATGATGGAAGAGG - Intergenic
905465384 1:38149156-38149178 TGCCCTTTCCATGATGGAAGAGG - Intergenic
907242977 1:53090840-53090862 GGCCCCAGCCATCCTGGAGGAGG - Intronic
908963046 1:69725277-69725299 TGCTCTTTCCATCTTGGAGGTGG + Intronic
909032738 1:70561243-70561265 TGCCCTTTCCATGATGGAAGAGG + Intergenic
909813257 1:79958701-79958723 AGGCCTAACAATCATGGTGGAGG + Intergenic
910588370 1:88902773-88902795 TGCCCTTTCCATGATGGAAGAGG - Intergenic
912251871 1:108020332-108020354 TGCCCTTCCCATGATGGAAGAGG + Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912943655 1:114067153-114067175 TGCCCTTTCCATGATGGAAGAGG + Intergenic
916285481 1:163100572-163100594 TGCCCTTTCCATGATGGAAGAGG - Intergenic
917227355 1:172799405-172799427 TGCCCAAAGCCTCATGGTGGGGG + Intergenic
919000589 1:191826823-191826845 TGCCCTTTCCATGATGGAAGAGG + Intergenic
919318123 1:196000396-196000418 TGCCCTTTCCATGATGGAAGAGG - Intergenic
920197586 1:204239409-204239431 TGCCCTTTCCATGATGGAAGAGG - Intronic
923465577 1:234245618-234245640 CGCTCTAAGCATCATGGAGCAGG - Intronic
1064323851 10:14330725-14330747 TGCCCTTACCATCCCCGAGGAGG + Exonic
1067754202 10:48992665-48992687 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1068447351 10:57139647-57139669 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1068837065 10:61567327-61567349 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1071266925 10:83972951-83972973 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1071425647 10:85546568-85546590 TGACCTCACACTCATGGAGGTGG + Intergenic
1071942633 10:90606722-90606744 TGCCCTTTCCATCATGGAAGAGG + Intergenic
1072209115 10:93230654-93230676 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1073557503 10:104466946-104466968 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1073656530 10:105423439-105423461 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1075268494 10:121026848-121026870 TGCCCTAACCACCAAAAAGGTGG - Intergenic
1075443958 10:122501001-122501023 TGCCCTGAGCATCTGGGAGGTGG + Intronic
1076772467 10:132673785-132673807 TGCCCTTCCCATGATGGAAGAGG + Intronic
1076927254 10:133498163-133498185 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1078192385 11:9102060-9102082 TGCCTTAACCAAAATGCAGGGGG + Intronic
1082110412 11:48267679-48267701 TGCCTTAACTGTCATTGAGGAGG - Intergenic
1084683257 11:70679410-70679432 TCCCCGGACCATCAGGGAGGTGG + Intronic
1085686108 11:78623214-78623236 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1088836805 11:113584409-113584431 TGCCCTTTCCATGATGGAAGTGG - Intergenic
1089903764 11:122014640-122014662 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1091051895 11:132379783-132379805 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1091718841 12:2797754-2797776 TGCCATAGCCACCATGAAGGTGG + Exonic
1092093433 12:5822663-5822685 TGCCCTTTCCATGATGGAAGAGG - Intronic
1093031713 12:14294906-14294928 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1093036496 12:14336705-14336727 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1093645864 12:21584687-21584709 TGCCCTTTCCATGATGGAAGAGG - Intronic
1095844236 12:46728946-46728968 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1096457310 12:51798419-51798441 TGCCCTTTCCATGATGGAAGAGG + Intronic
1096673892 12:53216124-53216146 TTCCCTAACTATCCAGGAGGTGG + Intronic
1097077143 12:56403424-56403446 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1097437682 12:59571235-59571257 TGCCCTTCCCATGATGGAAGAGG + Intergenic
1098716245 12:73830832-73830854 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1099490527 12:83283223-83283245 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1099700739 12:86078521-86078543 TGCCCTTTCCATGATGGAAGAGG + Intronic
1101264285 12:103067144-103067166 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1103035774 12:117655101-117655123 TGCCCTTTCCATGATGGAAGAGG - Intronic
1104533069 12:129590799-129590821 TTTTCTAACCAGCATGGAGGAGG + Intronic
1105740267 13:23316209-23316231 TGCCCTTCCCATGATGGAAGAGG - Intronic
1107260331 13:38482700-38482722 AACATTAACCATCATGGAGGAGG + Intergenic
1108780641 13:53826980-53827002 TGAACTAACCACCATGGTGGTGG + Intergenic
1109519174 13:63485830-63485852 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1109583187 13:64367196-64367218 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1109950874 13:69501186-69501208 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1110492258 13:76123620-76123642 AGTCCTCACAATCATGGAGGAGG - Intergenic
1111875083 13:93882831-93882853 TACCATAAACCTCATGGAGGAGG + Intronic
1111875277 13:93885656-93885678 TACCATAAACCTCATGGAGGAGG - Intronic
1112014043 13:95316668-95316690 TGCCCTGAGGATGATGGAGGAGG + Intergenic
1112790470 13:102997074-102997096 TGCCTTAACAATCATGCTGGGGG - Intergenic
1114206013 14:20571796-20571818 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1115059851 14:29174911-29174933 TGCCCTTTCCATGATGGATGAGG - Intergenic
1115951935 14:38731145-38731167 TGCCCCAACCACCCTGGAGTTGG - Intergenic
1116158235 14:41235630-41235652 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1116218661 14:42053554-42053576 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1116363948 14:44037510-44037532 TGGCCTACCCTTCATGGTGGGGG + Intergenic
1117956941 14:61130334-61130356 TGTCCCAACCATCAAGGAGAGGG - Intergenic
1120081868 14:80226506-80226528 TGCCCTTCCCATGATGGAAGAGG + Intronic
1120231296 14:81844214-81844236 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1123587376 15:21772417-21772439 TGCCCTGAACATCAGGGATGTGG + Intergenic
1123624014 15:22214982-22215004 TGCCCTGAACATCAGGGATGTGG + Intergenic
1124631415 15:31339701-31339723 TGCCCTGACCTGCAGGGAGGGGG - Intronic
1126283747 15:46987283-46987305 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1129830983 15:78670030-78670052 TGCCCTAACCCACATCAAGGCGG + Intronic
1130440273 15:83945982-83946004 TGCCCTAACCTAAAGGGAGGAGG + Intronic
1138080729 16:54088550-54088572 TGTCCTTACCATCAAGAAGGAGG - Intronic
1140187101 16:72784280-72784302 AACCCAAACCATCAGGGAGGGGG + Exonic
1141241704 16:82271028-82271050 GGCCCTCACAATCATGGTGGAGG + Intergenic
1142366060 16:89650363-89650385 TGCCCTGTCCATCATGGGGAGGG + Intronic
1143506227 17:7367113-7367135 TGCCCTCACCACCTTGGATGGGG - Intergenic
1145779440 17:27552628-27552650 TGCCCTAGCCTTCCTGGAGAGGG - Intronic
1145907676 17:28525130-28525152 TGGCCTGGCCAGCATGGAGGGGG + Intronic
1146851084 17:36222062-36222084 TGCCCTTTCCATGATGGAAGAGG - Intronic
1149255026 17:54816462-54816484 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1151225363 17:72643910-72643932 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1153089861 18:1331188-1331210 TGTCCTTTCCATGATGGAGGAGG - Intergenic
1154252408 18:12755658-12755680 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1156304003 18:35859720-35859742 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1156998721 18:43498754-43498776 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1157622272 18:49023457-49023479 AGCCCTAGACATCATGGACGGGG + Intergenic
1158850694 18:61493351-61493373 TGCGCTGAGCATCCTGGAGGAGG - Intronic
1159151755 18:64531670-64531692 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1159357135 18:67350733-67350755 TGGCCTCACAATCATGGTGGAGG - Intergenic
1160005219 18:75064081-75064103 TGCCCAGATCATCATGCAGGAGG + Exonic
1162524288 19:11198172-11198194 GGGCCTAACCATCAGGAAGGAGG + Intergenic
1162599685 19:11658459-11658481 TGCCCTGAGGATGATGGAGGTGG - Intergenic
1165830219 19:38726995-38727017 TGCCCGCACCATCAACGAGGTGG + Exonic
1168539180 19:57196380-57196402 TGCCCTTTCCATGATGGAAGAGG + Intronic
924991965 2:320077-320099 TGCCGTAACCAGCATGGATCAGG - Intergenic
925105406 2:1286670-1286692 TGCCCTTTCCATGATGGAAGAGG + Intronic
925499254 2:4485905-4485927 TGCCCTTCCCATGATGGAAGAGG + Intergenic
926810251 2:16749679-16749701 TGCCCTTTCCATGATGGAAGAGG + Intergenic
927637336 2:24825813-24825835 TTCCTTCACCATCCTGGAGGGGG + Intronic
930481021 2:51948229-51948251 TGCCCTTTCCATGATGGAAGAGG + Intergenic
932089914 2:68797384-68797406 TGCCATAGCCAGGATGGAGGAGG - Intronic
933504637 2:83161743-83161765 TGCCCTTTCCATGATGGAAGAGG + Intergenic
935564154 2:104589231-104589253 TGCCCTTTCCATGATGGAGGAGG + Intergenic
937581918 2:123498123-123498145 TGCCCTTTCCATGATGGAAGAGG + Intergenic
939069230 2:137518912-137518934 TGCCCTTTCCATGATGGAAGAGG - Intronic
940471947 2:154112094-154112116 TGCCCTTTCCATGATGGAAGAGG + Intronic
941832766 2:169980457-169980479 TGCCTTTACCCTCAAGGAGGTGG - Intronic
943383921 2:187180067-187180089 TGCCCTTTCCATGATGGAAGAGG + Intergenic
943517445 2:188906230-188906252 TGCCCTTTCCATGATGGAAGAGG + Intergenic
943733525 2:191328766-191328788 AGGCCAAAACATCATGGAGGTGG - Intronic
943833470 2:192490131-192490153 TGCCCTTTCCATGATGGAAGAGG + Intergenic
945545005 2:211139135-211139157 TGCCCTTTCCATGATGGAAGAGG - Intergenic
945642329 2:212444863-212444885 TGCCCTTTCCATGATGGAAGAGG - Intronic
945717690 2:213379644-213379666 TGCCCTTTCCATGATGGAAGAGG + Intronic
1169024302 20:2355239-2355261 TGCCCAAACCATTCTGTAGGGGG + Intergenic
1174354142 20:49987250-49987272 TGGCCTAACCAGCTTGGAGGTGG + Intronic
1178005896 21:28219407-28219429 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1180591001 22:16937341-16937363 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1181081873 22:20420983-20421005 TGCCCTACTAAGCATGGAGGCGG - Intergenic
1182458055 22:30464955-30464977 GGCTATAACCATTATGGAGGGGG - Intronic
1182741004 22:32567469-32567491 TGCCATAAGCTCCATGGAGGCGG - Intronic
1182965856 22:34520324-34520346 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1183411894 22:37659615-37659637 TGCCCTACCCACCATCGGGGTGG + Intronic
1184285626 22:43469570-43469592 TGGCCTGACCATCACGGAGTGGG - Intronic
949125314 3:440212-440234 TGCCCTTTCCATGATGGAAGAGG + Intergenic
949169890 3:985575-985597 TGCCCTTTCCATGATGGAAGAGG + Intergenic
949445763 3:4132084-4132106 TGCCCTTTCCATGATGGAAGAGG - Intronic
952529908 3:34252771-34252793 TGCTCCAACAATCCTGGAGGAGG - Intergenic
954054310 3:48008964-48008986 TGCCCTTTCCATGATGGAAGAGG - Intronic
954734159 3:52691444-52691466 TGCCCTAAACATCAGGGAAATGG + Intronic
957247424 3:77732874-77732896 TGCCCTTTCCATGATGGAAGAGG + Intergenic
958845638 3:99261398-99261420 TGCCCTTCCCATGATGGAAGAGG + Intergenic
959998018 3:112699345-112699367 TGCCCTTTCCATGATGGAAGAGG - Intergenic
960494592 3:118359731-118359753 TGCCCTTTCCATGATGGAAGCGG + Intergenic
960674485 3:120181268-120181290 GTCCTTAACCATCATGGTGGGGG - Exonic
961586761 3:127935210-127935232 TGCCCAAACCATCATTAAGTTGG + Intronic
963258337 3:143168908-143168930 TGCCCTGACCCACATGGAGATGG - Intergenic
965226613 3:165999745-165999767 TGCCCTTTCCATGATGGAAGAGG + Intergenic
966044183 3:175529894-175529916 TGCCCTTTCCATAATGGAAGAGG + Intronic
968494936 4:910323-910345 GGCCCTGAGCTTCATGGAGGGGG - Intronic
968800336 4:2739156-2739178 TGCCCTTTCCATGATGGAAGAGG - Intergenic
970629434 4:17924528-17924550 TGCCCTTTCCATGATGGAAGAGG - Intronic
970644931 4:18108944-18108966 TGCCCTTTCCATGATGGAAGAGG + Intergenic
970718655 4:18959370-18959392 TGGCCTCACAATCATGGTGGAGG + Intergenic
971857515 4:32061829-32061851 TGCCCATACCATGATGGAAGAGG + Intergenic
972085364 4:35208111-35208133 TGCCCTTTCCATGATGGAAGAGG - Intergenic
972201159 4:36716157-36716179 TGCCCTTTCCATGATGGAAGAGG + Intergenic
973103067 4:46295769-46295791 TGCCCTTTCCATGATGGAAGAGG - Intronic
974478909 4:62419866-62419888 TGCCCTTTCCATGATGGAAGAGG + Intergenic
974564926 4:63569336-63569358 TGCCCTTTCCATGATGGAAGAGG - Intergenic
974727368 4:65813564-65813586 TGCCCTTTCCATGATGGAGGAGG - Intergenic
977430914 4:96929233-96929255 TGCCCTTTCCATGATGGAAGAGG - Intergenic
979099660 4:116599105-116599127 TGCCCCAACCATCATCGAGGTGG + Intergenic
979888428 4:126061156-126061178 TGCCCTTTCCATGATGGAAGAGG + Intergenic
981835148 4:149044964-149044986 TGCCCTTTCCATGATGGAAGAGG - Intergenic
982835696 4:160117671-160117693 TGCCCTTTCCATGATGGAAGAGG - Intergenic
983027550 4:162756314-162756336 TGCCCTTTCCATGATGGAAGAGG - Intergenic
985934391 5:3084114-3084136 TGCCCTCTCCATCTTGAAGGTGG + Intergenic
986531253 5:8739292-8739314 TGCCCTTTCCATGATGGAAGAGG + Intergenic
986938194 5:12917726-12917748 TGCCCTTTCCATGATGGAAGAGG + Intergenic
986959979 5:13200208-13200230 TGCCCTTTCCATGATGGAAGAGG - Intergenic
987153331 5:15062690-15062712 TGCCATATCCATGATGGAAGAGG - Intergenic
987515256 5:18898758-18898780 TGCCATTCCCATTATGGAGGAGG - Intergenic
987578197 5:19757285-19757307 TGACCTTTCCATGATGGAGGAGG + Intronic
988169063 5:27631812-27631834 TGCCCTTTCCATGATGGAAGAGG + Intergenic
988205154 5:28124327-28124349 TGCCCTTTCCATGATGGAAGAGG + Intergenic
988785376 5:34561888-34561910 TGCCCTTTCCATGATGGAAGAGG + Intergenic
991330592 5:65488656-65488678 TGCCCTTTCCATGATGGAAGAGG + Intergenic
991946294 5:71901150-71901172 TGCCCTTTCCATGATGGAAGAGG - Intergenic
993203539 5:84848569-84848591 TGCCCTTTCCATGATGGAAGAGG - Intergenic
993319966 5:86459597-86459619 TGCCCTTTCCATGATGGAAGGGG - Intergenic
993583807 5:89698348-89698370 TGCCCTAGGCATAATTGAGGTGG - Intergenic
993780820 5:92063416-92063438 TGCCCTTTCCATGATGGAAGTGG - Intergenic
995135258 5:108673528-108673550 TGCCCTGTGCATGATGGAGGAGG + Intergenic
996164821 5:120211490-120211512 TGCCCTTTCCATGATGGAAGAGG + Intergenic
996318498 5:122188159-122188181 TGCCCTAGGCATCATGGAGCTGG + Intergenic
996825712 5:127678853-127678875 TGCCCTTTCCATGATAGAGGAGG - Intergenic
1000417120 5:160994927-160994949 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1003695753 6:8405137-8405159 TGCCCTTTCCATGATGGAAGGGG + Intergenic
1003791378 6:9551074-9551096 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1006062491 6:31434228-31434250 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1008079238 6:47177543-47177565 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1008272477 6:49506556-49506578 TTCCTTAGCAATCATGGAGGGGG + Intronic
1008820540 6:55626168-55626190 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1009806635 6:68607970-68607992 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1010107800 6:72189545-72189567 TGCCCTTTCCATGATGGAAGAGG + Intronic
1010938099 6:81885397-81885419 TGCCCTTTCCATAATGGAAGAGG + Intergenic
1011039206 6:83012274-83012296 TGCCCTTTCCATGATGGAAGAGG + Intronic
1011667445 6:89648275-89648297 TGCTCTAACCCTCCTGGAAGTGG - Exonic
1013301889 6:108811624-108811646 TGCCCTATGCATCGTGGAAGTGG + Intergenic
1014417143 6:121196432-121196454 TGCCCTTTCCATAATGGAAGAGG - Intronic
1014534041 6:122595578-122595600 TGCCCTTTCCATGATGGAAGAGG + Intronic
1015475901 6:133658508-133658530 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1016040139 6:139424253-139424275 TGCCCTGCTCATCATGGTGGGGG + Intergenic
1016147179 6:140691688-140691710 TGCCCTATCCATTATGGAAGAGG + Intergenic
1017976887 6:159366121-159366143 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1018534887 6:164809481-164809503 TGCCCTTTCCATGGTGGAGGAGG + Intergenic
1018600033 6:165528526-165528548 TGCCCTTTCCATGATGGAAGAGG - Intronic
1019729386 7:2622105-2622127 GGCCCTTCCCATCCTGGAGGTGG - Intergenic
1019961277 7:4461981-4462003 AGCCTTAACCATCAGGGAGCAGG + Intergenic
1021355692 7:19651226-19651248 TGCCCTAACCACCATTGGGCTGG + Intergenic
1021988964 7:26123947-26123969 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1024040691 7:45551172-45551194 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1024709949 7:52004376-52004398 TGCCCTTATCATCAAGGAAGAGG + Intergenic
1028237974 7:88383845-88383867 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1030956224 7:115855952-115855974 AGGCCTCACAATCATGGAGGAGG + Intergenic
1032923337 7:136575103-136575125 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1033034581 7:137861956-137861978 TGCCCTAAACATCCTGAAAGAGG + Intergenic
1033076413 7:138254072-138254094 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1033955062 7:146837183-146837205 TGCCCTAACAATCATGCAAGTGG - Intronic
1037382658 8:18303880-18303902 AGCCCTAACCATCAGAGAGATGG + Intergenic
1038585905 8:28789292-28789314 TGGCCTAAGCATTATGTAGGTGG - Intronic
1040912088 8:52529440-52529462 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1046585639 8:116146713-116146735 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1048898167 8:139013460-139013482 TTCCCTGACCATCAAGGAAGTGG - Intergenic
1049098056 8:140560445-140560467 TGCTCTAACCCTCTTGGCGGGGG - Exonic
1050556389 9:6792976-6792998 TGCCCTAACCATCATGGAGGTGG + Exonic
1052368799 9:27641862-27641884 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1056314085 9:85371920-85371942 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1058259118 9:102808663-102808685 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1059947057 9:119420240-119420262 TGCCCTGACCATTATGCAGAAGG + Intergenic
1060009692 9:120032642-120032664 TGGCATAACCCTCATGAAGGAGG - Intergenic
1062135624 9:134926033-134926055 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1062271353 9:135711170-135711192 TGCCCTTGCCATCATAAAGGAGG - Intronic
1185760192 X:2684645-2684667 TGCTCTCACCATCAAGGAGGTGG - Intergenic
1186279656 X:7978142-7978164 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1186469616 X:9811111-9811133 TGCCCTTGCCATGATGGAAGAGG + Intronic
1188473410 X:30565066-30565088 TGCCCTAATCATGATGGATTTGG - Intronic
1191719099 X:64214688-64214710 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1191933056 X:66395168-66395190 TGCCCTTTCCATTATGGAAGAGG - Intergenic
1191946495 X:66540044-66540066 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1192297568 X:69867004-69867026 TGCCCTTTCCATAATGGAAGAGG + Intronic
1192661430 X:73046762-73046784 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1192673113 X:73167385-73167407 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1193447303 X:81619786-81619808 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1193914673 X:87350922-87350944 TGCCCTTTCCATGATGGAAGAGG + Intergenic
1194082658 X:89487553-89487575 TGGCCTCACAATCATGGTGGAGG + Intergenic
1194179461 X:90694914-90694936 TGCCCTTTCCATAATGGAAGAGG + Intergenic
1194457094 X:94118509-94118531 TGCCCTTTCCATAATGGAAGAGG - Intergenic
1194584258 X:95714083-95714105 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1194767923 X:97864187-97864209 TGGCCTAACTCTCATGGATGTGG + Intergenic
1197182245 X:123548804-123548826 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1197592022 X:128420409-128420431 TGCCCTTTCCATGATGGAAGAGG - Intergenic
1198883564 X:141308021-141308043 AGGCCTCACAATCATGGAGGAGG + Intergenic
1198934181 X:141888880-141888902 TGCCCTTTCCATGATGGAAGAGG - Intronic
1200526125 Y:4277087-4277109 TGCCCTTTCCATAATGGAAGAGG + Intergenic
1202138081 Y:21687817-21687839 TGCCCTTTCCATGATGGAAGAGG - Intergenic