ID: 1050578305

View in Genome Browser
Species Human (GRCh38)
Location 9:7023150-7023172
Sequence ACTTCCAAGCTCACTCCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 484}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050578305_1050578310 16 Left 1050578305 9:7023150-7023172 CCTCACGGAGTGAGCTTGGAAGT 0: 1
1: 0
2: 2
3: 81
4: 484
Right 1050578310 9:7023189-7023211 CTTTTTGGAAGAGTTTAAGTAGG No data
1050578305_1050578311 21 Left 1050578305 9:7023150-7023172 CCTCACGGAGTGAGCTTGGAAGT 0: 1
1: 0
2: 2
3: 81
4: 484
Right 1050578311 9:7023194-7023216 TGGAAGAGTTTAAGTAGGATTGG No data
1050578305_1050578306 1 Left 1050578305 9:7023150-7023172 CCTCACGGAGTGAGCTTGGAAGT 0: 1
1: 0
2: 2
3: 81
4: 484
Right 1050578306 9:7023174-7023196 TTCCCTCATCCTCTACTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050578305 Original CRISPR ACTTCCAAGCTCACTCCGTG AGG (reversed) Intronic
901189330 1:7397008-7397030 TCTTCCAAACTCATTCTGTGAGG - Intronic
901523205 1:9801521-9801543 ACTTCCTAACTCATTCTGTGAGG + Intronic
901609616 1:10487308-10487330 ACTGCCAAACTCACTCCATGAGG - Intronic
903167371 1:21530382-21530404 ACTTGTGAGCTTACTCCGTGGGG + Intronic
904324700 1:29720814-29720836 ACTTCCAAGATGATTCCTTGTGG + Intergenic
905331644 1:37206237-37206259 ACTTCCAAGCTCACTTTATAGGG + Intergenic
905711738 1:40110386-40110408 ACTTCCTAACTCACTCTATGAGG + Intergenic
906134601 1:43488540-43488562 ACTTCCCAGCTCATTTTGTGAGG - Intergenic
907605213 1:55809792-55809814 ACTTCCAAACTCATTCTATGAGG + Intergenic
909316574 1:74227335-74227357 ACTTCCAAACTTATTCCATGAGG + Intronic
909460280 1:75904371-75904393 ACTTCCAAACTCATTCTATGAGG - Intronic
909848521 1:80430261-80430283 ACTTCCAAACTCATTCTCTGAGG - Intergenic
910273643 1:85424219-85424241 ACTTCCTAACTCATTCTGTGTGG - Intronic
910384770 1:86669699-86669721 ACTTCTAAACTCATTCTGTGAGG + Intergenic
910899068 1:92100329-92100351 ACTTCCCAACTCATTCTGTGAGG - Intronic
911853372 1:102846917-102846939 ACTTTCAAACTCATTCTGTGAGG + Intergenic
911992465 1:104718647-104718669 ACTTCCCAACTGACTCCTTGAGG + Intergenic
912016532 1:105044159-105044181 ACTTCCAAACTCATTCTGTGAGG + Intergenic
912053503 1:105564091-105564113 ACTTCCAAACTCACTCTATGAGG + Intergenic
912127621 1:106559254-106559276 ACTTCCAAGCTCATTCTATGAGG + Intergenic
912139189 1:106700797-106700819 ACTTCCAGGCTCATTCCTTCTGG - Intergenic
912601438 1:110938191-110938213 ACTTCCAAACTCATTCTATGAGG + Intergenic
913036610 1:114971926-114971948 ACTTCCAAACTCATTCTATGAGG - Intronic
915089655 1:153415690-153415712 ACCTCCAGGCTCATTCCATGGGG + Intergenic
916322245 1:163517768-163517790 ACTTCCAAGCTCATTGTATGAGG + Intergenic
916627227 1:166571531-166571553 ACTACCATGCACACTCCTTGAGG - Intergenic
917061332 1:171044471-171044493 ACTTCCAATATCATTCTGTGAGG - Intronic
917383722 1:174444450-174444472 ACTTCCAAACTCATTCTGTGAGG - Intronic
917396251 1:174597226-174597248 ACTTCCAAACTCATTCTATGAGG - Intronic
918746975 1:188215025-188215047 ACTTGCAAATTCACTCTGTGAGG - Intergenic
919068152 1:192719688-192719710 ACTTCCAAACTCATTCTATGAGG + Intergenic
919215455 1:194547596-194547618 ACTTCCAAACTCATTCTATGAGG - Intergenic
920268038 1:204741118-204741140 ACTTCCAAACTCATTCTATGAGG - Intergenic
920299177 1:204977917-204977939 ACTTCCGAGCTCACCCTGTAAGG - Intronic
920604584 1:207368911-207368933 ACTTCCAAACTCATTTCATGAGG + Intergenic
921241810 1:213192392-213192414 ACTTCCAAACTCAGTCTATGAGG - Intronic
921620979 1:217325905-217325927 ACTTCCATGCTCACTTCCTCAGG - Intergenic
921653740 1:217709391-217709413 ACTTCCAAGCTCACTCACATAGG + Intronic
921874621 1:220180713-220180735 ACTTCCAAACTCATTCTATGAGG + Intronic
921942608 1:220858313-220858335 ACTTCCAAACTCATTCTATGAGG - Intergenic
922408984 1:225350870-225350892 ACTTCCTAACTCATTCTGTGAGG + Intronic
924515791 1:244764683-244764705 ACTTCCAAACTCATTCTATGAGG - Intergenic
924832239 1:247609340-247609362 ACTTCCAAACTTATTCCATGAGG + Intergenic
1063306357 10:4904988-4905010 ACTTCCAAACTCATTCTATGAGG - Intergenic
1064666512 10:17657472-17657494 ACTTCCTAACTCATTCTGTGAGG - Intronic
1064696485 10:17971344-17971366 ACTTCCGAACTCATTCCATGAGG - Intronic
1065906973 10:30263955-30263977 ACTTCCAAACTCATTCTATGAGG + Intergenic
1067132783 10:43580630-43580652 ACTTCCAAACTCATTCTATGAGG - Intergenic
1067200178 10:44162396-44162418 GCTTTCCAGCTCACTCTGTGAGG - Intergenic
1067215926 10:44302826-44302848 ACTTCCAAGCTCATTCTAAGAGG + Intergenic
1068448124 10:57149996-57150018 ACTTCCAGACTCACTCTATGAGG + Intergenic
1068713545 10:60160532-60160554 ACTTCCAAACTCATTCTATGAGG + Intronic
1068999510 10:63247886-63247908 ACTTCCAAACTCATTCCTTGAGG + Intronic
1069343923 10:67445075-67445097 ACTTCCAAACTCATTCCATGAGG + Intronic
1069700908 10:70425101-70425123 ACTTCCAAGTTCTCTCTTTGTGG + Exonic
1070854701 10:79597747-79597769 TCTTCCAAACTCATTCCATGGGG + Intergenic
1071957077 10:90770892-90770914 AGTTCCCATCTCAGTCCGTGTGG - Intronic
1072390416 10:94979348-94979370 ACTTCCAAACTCATTCTATGAGG - Intronic
1072515210 10:96175170-96175192 ACTTCCCAGCTCATTCTATGAGG + Intronic
1072843426 10:98800857-98800879 ACTTCCAAACTCATTCTGTGAGG + Intronic
1073872713 10:107884226-107884248 ACTTCCAAACTCATTCTATGAGG + Intergenic
1075957287 10:126534937-126534959 ACTTCCCACCTCACTCCTTCAGG + Intronic
1076326840 10:129630361-129630383 TCTTCCCATCTCACGCCGTGAGG + Intronic
1077323083 11:1951072-1951094 ACTTCCGGGCTCACTCCACGGGG - Intronic
1077842655 11:5992073-5992095 ATTTCCCAGCTCACTGCATGAGG - Intergenic
1077872660 11:6275619-6275641 ACTTCCAAACTCATTCTGTGAGG + Intergenic
1077939219 11:6822649-6822671 ACTTCCCAATTCACTCTGTGAGG + Intergenic
1078244096 11:9557683-9557705 ACTTTCAAACTCATTCCATGAGG - Intergenic
1078381269 11:10843309-10843331 ACTTCCAAGCTTACTCCTGTTGG - Intronic
1079041171 11:17061250-17061272 ACTTCCAATCTCATTCTATGAGG + Intergenic
1079113890 11:17627599-17627621 ACTTCCAAACTCATTCTATGAGG - Intronic
1079728990 11:23916781-23916803 ACTTCCAAACTCATTCTGTGAGG - Intergenic
1079763691 11:24362196-24362218 TCTTCCAAGCTCATTCTATGAGG + Intergenic
1079824650 11:25175456-25175478 CCTTACAAGCTCCCTCCCTGGGG + Intergenic
1080097086 11:28421345-28421367 ACTTCCAAACTCATTCTATGAGG + Intergenic
1080509398 11:32952608-32952630 ACTTCCCAACTCATTCTGTGAGG - Intronic
1081642898 11:44769404-44769426 ACTTCCTAACTCATTCTGTGAGG - Intronic
1082900430 11:58243952-58243974 ACTTCCAAAATCATTCCATGAGG - Intergenic
1082954055 11:58849998-58850020 ACTTCCAAACTCATTCTATGAGG + Intronic
1082971246 11:59023621-59023643 ACTTCCAAACTCATTCTATGAGG + Intronic
1083527936 11:63388682-63388704 ACTTCCAAACTCATTCTATGAGG - Intronic
1085223774 11:74899883-74899905 ACTTCCAAACTCATTCTATGAGG + Intronic
1086277049 11:85143061-85143083 ACTTCCAAACTCATTTCATGAGG - Intronic
1086363416 11:86083180-86083202 ACTTCCTAACTCATTCCATGAGG - Intergenic
1086481921 11:87249821-87249843 ACTTCCAAACTCATTCTATGAGG - Intronic
1086524316 11:87706860-87706882 ACTTCCAAACTCATTCTATGTGG - Intergenic
1087053995 11:93914626-93914648 ACTTCCAAGCTCATTCTATGGGG - Intergenic
1088273955 11:108064855-108064877 ACTTCCAAACTCATTCTATGAGG - Intronic
1088523752 11:110728821-110728843 ATTTCCAAGCTCCTTCCATGTGG + Intergenic
1088985539 11:114903602-114903624 ACTTCCAAACTCATTCTATGAGG + Intergenic
1090111505 11:123915026-123915048 ACTTCCAAACTCATTCTATGAGG + Intergenic
1090317946 11:125813329-125813351 ACTTCCAAACTCATTCTGGGAGG - Intergenic
1202806068 11_KI270721v1_random:6267-6289 ACTTCCGGGCTCACTCCACGGGG - Intergenic
1091684399 12:2551333-2551355 ACTGCCAGGCTCCATCCGTGGGG - Intronic
1091925055 12:4339529-4339551 ACTTCCAAACTTATTCTGTGAGG + Intronic
1092529416 12:9332135-9332157 ACTTCCAAGCTCACTCATGTGGG + Intergenic
1093095593 12:14968447-14968469 ACTTCCCAACTCATTTCGTGAGG - Intergenic
1093404831 12:18791497-18791519 ACTTTCAAACTCATTCTGTGAGG + Intergenic
1093897131 12:24586468-24586490 ACTTCCTAACTCATTCCATGAGG + Intergenic
1094559609 12:31539364-31539386 AATTCCAAACTCACTCTATGAGG + Intronic
1094812385 12:34151246-34151268 ACTTCCAAGCACACTCATTGTGG - Intergenic
1095143957 12:38701128-38701150 ACTTCCCAGCTCATTTTGTGAGG - Intronic
1095175441 12:39086653-39086675 ACTTCCAAACTCAATCTATGAGG - Intergenic
1096450171 12:51733578-51733600 ACTTCCAAACTCATTCTATGAGG - Intronic
1097668566 12:62510273-62510295 ACTTCCAAGCTCATTTTATGAGG + Intronic
1098333371 12:69376713-69376735 ACTTCCAAACTCATTCTATGAGG - Intronic
1099554156 12:84089482-84089504 ACGTCCTAGCTCATTCCGTAAGG - Intergenic
1099673632 12:85728572-85728594 ACTTCCAAGCTCATTCTGGGTGG + Intergenic
1099992585 12:89740926-89740948 ACTTCCACACTCACTCTGTGAGG + Intergenic
1100047568 12:90401787-90401809 ACTTCCAAACTTATTCCATGAGG + Intergenic
1100123113 12:91392542-91392564 ACTTCCAAACTTATTCTGTGAGG - Intergenic
1100804742 12:98270659-98270681 ACTTCCAAACTCATTCTATGAGG + Intergenic
1100833964 12:98547463-98547485 AATTCCAAGCACATTCCCTGAGG - Intronic
1101025826 12:100605099-100605121 ACTTCCAAACTCATTCTATGAGG - Intronic
1101227023 12:102698725-102698747 ACTTCCAAACTCATTCTGTGAGG + Intergenic
1105466742 13:20650111-20650133 ACTTCCTAACTCAGTCAGTGAGG + Intronic
1105558591 13:21469022-21469044 ACTTCCAAACTCATTCTATGAGG - Intergenic
1105713937 13:23042507-23042529 ACTTCCAAACTCATTCAGTGAGG - Intergenic
1106075117 13:26452917-26452939 ACTTCCAAACTCATTCTATGAGG + Intergenic
1106963756 13:35034531-35034553 ACTTCCAAACTCATTCCATGAGG - Intronic
1107265631 13:38550437-38550459 ACTTCCAAACTCATTCTATGAGG - Intergenic
1107523728 13:41209278-41209300 ACTTCCAAACTCATTCTCTGGGG - Intergenic
1107643325 13:42467733-42467755 ACTTCCAAACTTATTCTGTGAGG + Intergenic
1107847270 13:44529072-44529094 AATTCCTAGCTCATTCTGTGAGG + Intronic
1108138321 13:47389987-47390009 ACTTCCAAACTCATTCTATGAGG + Intergenic
1109336320 13:60999268-60999290 ACTTCCAAACTCATTCTGTGAGG - Intergenic
1109747986 13:66651644-66651666 GCTTCCAAACTCATTCCATGAGG + Intronic
1110377657 13:74812549-74812571 ACTTCCAAACTCATTCTTTGAGG + Intergenic
1110518995 13:76452187-76452209 ACTTCCAAACTCATTCTATGAGG + Intergenic
1110665443 13:78111947-78111969 ACTTCCAAACTCATTCTATGAGG - Intergenic
1110827064 13:79984136-79984158 ACTTCCTAACTCATTCCATGAGG - Intergenic
1111511069 13:89263268-89263290 ACTTCCAAACTCATTCTATGAGG - Intergenic
1111547625 13:89763393-89763415 ACTTCCAAGCTCATTCTGAGAGG + Intergenic
1112658411 13:101477967-101477989 ACTTCCAAACTAATTCTGTGAGG + Intronic
1113038603 13:106079755-106079777 ACTCCCAAGCTCACACCATGAGG + Intergenic
1113954711 13:114091718-114091740 ACTTCCAAACTCAAGCAGTGAGG - Intronic
1114072344 14:19123187-19123209 ACTTCCAAACTCATTCTATGAGG - Intergenic
1114089914 14:19276786-19276808 ACTTCCAAACTCATTCTATGAGG + Intergenic
1114506838 14:23222614-23222636 ACTTCCAAACTCATTCTATGAGG + Intronic
1115134533 14:30092847-30092869 ACTTCCAAGCTCATTCTATGAGG + Intronic
1115538802 14:34399693-34399715 ACTTCCAAACTCACTTTGTGAGG + Intronic
1115619567 14:35128352-35128374 ACTTCCAAACTCATTCCATGAGG - Intronic
1116125910 14:40784908-40784930 ACTTGCATGCTCCCTCCCTGAGG - Intergenic
1116149233 14:41117418-41117440 ACTTCCAAACTCATTCTATGAGG + Intergenic
1116192903 14:41682940-41682962 ACTTCCAAACTCCTTCTGTGAGG + Intronic
1116434588 14:44882319-44882341 ACTTCCAAACTCATTCTATGAGG + Intergenic
1116809908 14:49529508-49529530 ACTTCCAAACTCATTCTATGAGG + Intergenic
1117504106 14:56384397-56384419 ACTTCCAAATTCATTCTGTGAGG - Intergenic
1118969889 14:70626177-70626199 ACTTCCAAGCTCATTCTATAAGG + Intergenic
1121929790 14:97962019-97962041 TCTTCCAAGCCCAGTCAGTGGGG + Intronic
1122435931 14:101698458-101698480 ACTTCCAAACTCATTCTATGAGG + Intergenic
1124148027 15:27148481-27148503 GCTTCCAAGCTCATTCTATGAGG + Intronic
1124222102 15:27859653-27859675 ACTTCCTAACTCATTCCATGAGG + Intronic
1125272908 15:37959337-37959359 ACTTCCAAACTCATTCTGTAAGG + Intronic
1126078996 15:44939965-44939987 ACTTCCCAGCCAACTCAGTGGGG - Intergenic
1126534320 15:49744238-49744260 ACTTCCAAACTCATTCTATGAGG + Intergenic
1127196761 15:56594855-56594877 ACTTCCAAGCTCATTCTATGAGG + Intergenic
1127398893 15:58565476-58565498 GCTTCAATGCTCACCCCGTGTGG - Intronic
1127493540 15:59487883-59487905 ACTTCCAAACTCATTCTATGAGG + Intronic
1128325100 15:66719205-66719227 ACTGCCTAGCTCACACCCTGAGG + Intronic
1128572193 15:68741857-68741879 ACTTCCAAGCTCACTCGGGTTGG - Intergenic
1128777388 15:70332069-70332091 ACTTCCCAGCTCACTTTATGAGG - Intergenic
1129997462 15:80018908-80018930 ACTTCCTAGCTCATTCTGTGAGG - Intergenic
1130580095 15:85129255-85129277 ACTTCCTAACTCATTCCATGAGG - Intronic
1130601524 15:85278105-85278127 ACTTCCAAGCTCCCTCAACGTGG - Intergenic
1131240024 15:90731384-90731406 ACTCCCCAGCTCATTCTGTGAGG - Intronic
1131320873 15:91389582-91389604 ACTTCCAAACTCACTCTGTGAGG - Intergenic
1131397218 15:92096180-92096202 ACTTCCAAGCTCACTGCCATGGG + Intronic
1131950479 15:97675834-97675856 ACTTCCAAGCTCCTTGCATGTGG + Intergenic
1133952386 16:10406892-10406914 ACTTCCAAACTCATTCCATGAGG + Intronic
1134088727 16:11377803-11377825 ACCTCCAAACTCACTCTGTGAGG - Intronic
1138058856 16:53866387-53866409 ACTTCCAAACTCATTCTTTGCGG - Intronic
1138300476 16:55923647-55923669 ACTTCCAAACTCATTCTATGAGG + Intronic
1138544816 16:57710989-57711011 ACTTCCCAACTCATTCCATGAGG - Intronic
1138596016 16:58029287-58029309 ACTTCCATGCTGGCTCCGGGGGG + Intronic
1140543035 16:75777327-75777349 ACTTCCAAACTCATTCTATGAGG + Intergenic
1143348920 17:6272453-6272475 ACACCCAAGTTCACTTCGTGTGG + Intergenic
1144048518 17:11475798-11475820 ACTTCCTAACTCATTCTGTGAGG - Intronic
1146368519 17:32248753-32248775 ACTTCCCAACTCATTCTGTGAGG - Intronic
1146754267 17:35413297-35413319 ACTTCCAAACTCATTTCATGAGG + Intronic
1149004123 17:51787182-51787204 ACTTCCAAGTTCATTCTATGAGG - Intronic
1151018620 17:70586251-70586273 ACTTGCAAGCTCACTCCCATGGG + Intergenic
1151721099 17:75856260-75856282 ACCTCCGAGCTGAATCCGTGAGG + Exonic
1153388556 18:4528355-4528377 ACTTCCAAACTCAATCTGTGAGG - Intergenic
1153575565 18:6516915-6516937 ACTTTCAAGCTCATTCTATGAGG - Intronic
1154171926 18:12058746-12058768 ACTTCCAAACTTACTCTATGAGG + Intergenic
1154416081 18:14176486-14176508 ATTTCCAAACTTATTCCGTGGGG + Intergenic
1155534217 18:26799549-26799571 ACTTGCAAACTCATTCTGTGAGG + Intergenic
1155597656 18:27506799-27506821 ACTTCCAAACTCACTCTATGAGG + Intergenic
1156150190 18:34232820-34232842 ACTTCCTAGCTCATTCTGTGAGG + Intergenic
1156258341 18:35421193-35421215 ACTTCCAAACTCATTCTATGAGG - Intergenic
1156277824 18:35600947-35600969 ACTTCCAAACTCATTCTGTTAGG - Intronic
1157064884 18:44336858-44336880 ACTTCCAAACTCATTCTATGAGG - Intergenic
1158096399 18:53776942-53776964 ACTTCCAAACTCATTCTATGAGG - Intergenic
1160138162 18:76292613-76292635 ACTTCCAAACTCATTCCTTGAGG - Intergenic
1162313275 19:9920308-9920330 ACTTGCAAGCTCCCTCTTTGAGG + Intronic
1164674409 19:30091981-30092003 ACTGCCAAGCTCACTCATTTCGG + Intergenic
1164687980 19:30182724-30182746 ACTGCCAAACTCATTCTGTGAGG + Intergenic
1164832915 19:31336405-31336427 ACTTCGAATCTGTCTCCGTGTGG - Intronic
1165645931 19:37436953-37436975 ACTTCCAAACTCATTCCAGGAGG + Intronic
1166557069 19:43707307-43707329 CCTTCCAAGGTCACAACGTGGGG + Intergenic
1166973146 19:46584408-46584430 ACTTCCTACCTCATTCCATGAGG + Intronic
925187825 2:1861228-1861250 ACTTCCTATCTCCCTCCGGGAGG + Intronic
925269804 2:2595966-2595988 ACTTCCAAACTCACTCTATGAGG + Intergenic
925490578 2:4388314-4388336 ACTTCCAAACTCATTCTATGAGG - Intergenic
925598174 2:5578452-5578474 ACTTCTAAGCTCATTCTATGAGG + Intergenic
926291331 2:11533371-11533393 ACTTCAAAGCTGACTTTGTGAGG - Intergenic
926682295 2:15673185-15673207 ACTTTCAAGTTTCCTCCGTGTGG - Intergenic
927224126 2:20745063-20745085 ACTTCTAAGCTCCCTACATGTGG + Intronic
927361916 2:22245895-22245917 ACTTCCAACCTCAGGCCATGGGG + Intergenic
928271749 2:29861764-29861786 ACTTCCAAACTCACTTTATGAGG + Intronic
928494939 2:31822008-31822030 ACTTCCAAACTCATTCTATGAGG - Intergenic
928781679 2:34830045-34830067 ACTTCCAAACTCATTCTATGAGG - Intergenic
929064144 2:37956058-37956080 ACTCCCAAGCTCATTCTGTGAGG - Intronic
929540970 2:42820886-42820908 ACTTCCAAACTCATTCTATGAGG - Intergenic
930141888 2:47959936-47959958 ACTTCCAAACTCATTCTATGAGG + Intergenic
930527395 2:52546851-52546873 ACTTCAAAACTCATTCCATGAGG - Intergenic
931006156 2:57851607-57851629 ACTTCCAAACTCATTTTGTGAGG + Intergenic
931738205 2:65217497-65217519 ACTTCTTAGCTCTCTCCTTGAGG - Intergenic
931932230 2:67151828-67151850 ACTTCCAAACTCATTCTATGAGG + Intergenic
932049541 2:68384730-68384752 GCATCCACGCTCACTCAGTGAGG - Intronic
932471301 2:71961244-71961266 ACTTCCAAGCTCCTTACATGTGG + Intergenic
932602735 2:73140065-73140087 ACTTCCGAACTCATTCTGTGAGG - Intronic
932889854 2:75584016-75584038 ACTTCCAAACTCATTCTATGAGG + Intergenic
933078266 2:77956128-77956150 ACTTCCAAACTCATTCTATGAGG + Intergenic
933421048 2:82044838-82044860 ATTTCCAAACTCATTCTGTGAGG + Intergenic
933450961 2:82451004-82451026 ACTTCCAAACTCATTCTGTAAGG + Intergenic
933601325 2:84334349-84334371 ACTTCCAAACTCATTCTGTGAGG + Intergenic
934906040 2:98204720-98204742 ACTTCCCAACTCACTCTATGAGG - Intronic
935116517 2:100142016-100142038 CCTTGCAAGCTCACTCACTGGGG + Intronic
935325686 2:101934808-101934830 ACTTCCTAACACACTCTGTGTGG + Intergenic
935751526 2:106239207-106239229 ACTTCCAAACTCATTCTTTGAGG + Intergenic
936000458 2:108823272-108823294 ACTTCCACACTTACTCTGTGGGG + Intronic
936969189 2:118160402-118160424 ACTTCCAAACTCATTACATGAGG + Intergenic
937580954 2:123487460-123487482 CCTTCCAAGCTCCGTCCTTGTGG + Intergenic
937677401 2:124607335-124607357 ACTTCCAGGCTCACTCCTGTGGG + Intronic
937736912 2:125302796-125302818 ATTTCCAAACTTACTCTGTGAGG + Intergenic
938486587 2:131716674-131716696 ACTTCCAAACTCATTCTATGAGG - Intergenic
939503864 2:143019666-143019688 ACTTTCAAACTCATTCCATGAGG - Intronic
940387786 2:153093686-153093708 ACTTCCAAACTCATTCTGTGAGG - Intergenic
940400144 2:153239833-153239855 ACTTCCAAACTCATTCTATGAGG - Intergenic
940795747 2:158076303-158076325 ACTTCCAAACTTATTCCATGAGG + Intronic
941529209 2:166644558-166644580 ACTTCCTAGCTTATTCTGTGAGG - Intergenic
941780201 2:169435767-169435789 ACTTCCAAACTCATTCTGTGAGG + Intergenic
942527718 2:176872946-176872968 ACTTCCAAGCTCTTTACATGTGG + Intergenic
942778288 2:179611551-179611573 ACTTCCAAACTCATTCCACGAGG - Intronic
942971875 2:181966815-181966837 ACTTCCAAACTCATTCTATGAGG - Intronic
943275638 2:185864392-185864414 ACTTCCAAGCTCATTTTATGAGG + Intergenic
943301188 2:186203036-186203058 ACTTCCAAACTCACTCTATAAGG + Intergenic
943485157 2:188470068-188470090 ACTTCCAAACTCATTCTATGAGG - Intronic
943845401 2:192639241-192639263 ACTTCCAAACCCACTCTATGAGG + Intergenic
943857927 2:192822710-192822732 ACTTTCAAGCTCATTCTATGAGG + Intergenic
943994159 2:194737665-194737687 ACTTCCTAACTCCCTCCCTGAGG + Intergenic
944377319 2:199061800-199061822 ACTTCCAAGCTCATTCTATGAGG + Intergenic
945315388 2:208365679-208365701 ACTTCCAAGGTCATTCTTTGAGG - Intronic
948528027 2:238585243-238585265 ACTTCTAAGCTCCTTACGTGAGG + Intergenic
948739744 2:240036587-240036609 ACTTTCAAACTCATTCCATGAGG - Intergenic
948775004 2:240281833-240281855 ACTTCCAAACTCATTCTATGAGG + Intergenic
1169617620 20:7467283-7467305 ACTTCCAAACTCATTCTATGAGG - Intergenic
1170056175 20:12206234-12206256 ACTTCCAAGCTAACTACATGAGG - Intergenic
1170637539 20:18121335-18121357 ACTTCCTAACTCACTCTATGAGG + Intergenic
1171356093 20:24546668-24546690 ACAGCCAAGCTCAGTCAGTGTGG + Intronic
1171484114 20:25475389-25475411 ACTTCCAAACTCATTCTATGAGG + Intronic
1172372857 20:34408784-34408806 ACTTCCAAGCTTACACTGTAAGG - Exonic
1172891052 20:38264635-38264657 ACTTCCAAACTCATTCTATGAGG + Intronic
1175170717 20:57079386-57079408 ACTTCCAAGCTCATTCTATGAGG - Intergenic
1175747704 20:61471046-61471068 ACTTCCAAACTCATTATGTGAGG - Intronic
1175749815 20:61487766-61487788 GCTGCCAAGTTCACCCCGTGAGG + Intronic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1176857261 21:13982809-13982831 ACTTCCAAACTTATTCTGTGGGG - Intergenic
1176867347 21:14061421-14061443 ACTTCCAAACTTATTCTGTGGGG + Intergenic
1176999433 21:15593734-15593756 ATTTCCAAACTCACTCTATGAGG + Intergenic
1177758562 21:25375857-25375879 ACTTCCAAACTCATTCTATGAGG - Intergenic
1177850284 21:26338523-26338545 ACTTCCAAACTCATTCTATGAGG + Intergenic
1178003354 21:28189464-28189486 GCTTCCAAACTCATTCCATGAGG - Intergenic
1178825278 21:36010355-36010377 ACCTCCAAACTCACTCTGTGAGG + Intergenic
1179364739 21:40747700-40747722 ACTTCCAAACTCATTCTATGAGG + Intronic
1180029299 21:45193071-45193093 ACTTCCCAACTCATTCTGTGAGG + Intronic
1180490790 22:15845561-15845583 ACTTCCAAACTCATTCTATGAGG - Intergenic
1181663779 22:24375306-24375328 ACTTCCTAACTCATTCTGTGAGG + Intronic
1182201567 22:28576493-28576515 ACTTCCAAACTCATTCTATGAGG - Intronic
1182936937 22:34232508-34232530 ACTTCCAAACTCATTCTATGAGG + Intergenic
1183497589 22:38157586-38157608 ACTTCCAAACTCATTCTATGAGG + Intronic
1183620761 22:38970973-38970995 ACCTCCTAGCCCACTCCTTGGGG - Intronic
1184745058 22:46451261-46451283 CCTTCCCAGCTCCCTCCTTGTGG - Intronic
950596191 3:13984578-13984600 ACTTCCAAACTCATTCTATGAGG - Intronic
950843598 3:15992163-15992185 ACTTCCTAACTCATTCCATGAGG - Intergenic
951028575 3:17856284-17856306 ACTTCCAAACTCATTCTATGAGG - Intronic
951279332 3:20728673-20728695 ACTTCCAAACTCACTCTATAAGG - Intergenic
951492497 3:23287432-23287454 ACTTCCCAATTCATTCCGTGAGG - Intronic
951818294 3:26780573-26780595 ACTTCCAAACTCATTCTATGAGG - Intergenic
951857849 3:27217630-27217652 ACTTCCCAACTCATTCTGTGAGG + Intronic
951860609 3:27247880-27247902 ACTTCCAAACTTACACCGTGAGG - Intronic
952132323 3:30379388-30379410 ACTTCCAACCTCATTCTATGAGG - Intergenic
952143611 3:30506633-30506655 ACTTCCAAACTCATTCGATGAGG + Intergenic
952149382 3:30570974-30570996 ACTTCCAAACTCATTCTATGAGG + Intergenic
952222285 3:31336107-31336129 ACTTCCAAACTCATTCTATGAGG + Intergenic
952291941 3:32025512-32025534 ACTTCCCAGCTCATTCAATGAGG - Intronic
953229129 3:41048413-41048435 ACTTCCAAACTCATTCTATGAGG - Intergenic
954585190 3:51728546-51728568 ACTTCCAAGCTCATTCTATGAGG - Intergenic
954949375 3:54456618-54456640 ACTTCCAAACTCACTCTATGAGG - Intronic
957485868 3:80861986-80862008 ACTTCCAAACTCATTCTATGAGG + Intergenic
957668331 3:83266705-83266727 ACTTCCTAACTCATTCTGTGAGG + Intergenic
957745483 3:84335887-84335909 ACTTCCAACCTCATTCTATGAGG - Intergenic
957835585 3:85584854-85584876 ACTTCTAAGCTAACTTCTTGTGG + Intronic
957966449 3:87327493-87327515 ACTTCCTAACTCAATCTGTGAGG + Intergenic
958976684 3:100675616-100675638 ACTTCTAAACTCACTCCATGAGG - Intronic
959113934 3:102153414-102153436 ACTTCCAAACTCATTCTATGAGG + Intronic
959810154 3:110608567-110608589 ACTTCCTAACTCATTCCATGAGG + Intergenic
959818720 3:110706055-110706077 ACTTCCACACTCATTCCATGAGG - Intergenic
960792182 3:121445117-121445139 ACTTCCAGACTCATTCTGTGAGG - Intronic
962038020 3:131674323-131674345 ACTTCCAAACTCATTCTATGAGG - Intronic
962584269 3:136825909-136825931 ACTTCCGAACTCACTCTATGAGG - Intronic
962734335 3:138311376-138311398 ACTTCCAAACTCATTCTGTGAGG + Intronic
962758849 3:138489714-138489736 ACTTCCAACCTCATTCTGTGAGG - Intergenic
962927399 3:140007623-140007645 CCTTGCAAGCTCACTCTGAGTGG - Intronic
963459403 3:145589223-145589245 ACTTCCAAACTCACTATATGAGG + Intergenic
963745694 3:149122926-149122948 ACTTCCCAACTTACTCTGTGAGG - Intergenic
963824930 3:149943188-149943210 ACTTCCAAACTCATTCTATGAGG - Intronic
965065042 3:163837530-163837552 AATTCCAAACTAACTCCATGAGG + Intergenic
965379368 3:167968577-167968599 ACTTCCAAACTCATTCTGTGAGG + Intergenic
965380810 3:167985504-167985526 ACTTCCAAACTCATTCTATGAGG + Intergenic
965848960 3:172999047-172999069 ACTTCCAAACTCATTCTATGAGG - Intronic
966374608 3:179282763-179282785 ACTTCCAAACTCATTCTATGAGG + Intergenic
966513893 3:180795637-180795659 ACTTCCAAACTCATTCTATGAGG - Intronic
967039757 3:185680436-185680458 ATTTCCAAGCTCATTCCATGAGG + Intronic
967636954 3:191813148-191813170 ACTTCCAAAATCATTCTGTGAGG + Intergenic
967950036 3:194833570-194833592 ACTTCCAAGCTCACTCAGGTGGG - Intergenic
970478348 4:16448460-16448482 ATTTCCAAGGTCAGTCCCTGCGG + Intergenic
970821536 4:20221161-20221183 ACTTCCAAACTCATTCTATGAGG - Intergenic
970971834 4:21993382-21993404 ATTTCCAAACTCATTCTGTGAGG + Intergenic
971543761 4:27857818-27857840 ACTTCTAAGCTCATTCTATGAGG - Intergenic
971557512 4:28033230-28033252 ACTTCCAAACTCATTCTATGAGG + Intergenic
973327070 4:48873405-48873427 ACTTCCAAACTCATTCTATGAGG - Intergenic
973659033 4:53083432-53083454 ACTTCCAACCTTATTCTGTGAGG + Intronic
974189411 4:58484893-58484915 ACTTCCTAACTCACTCAATGTGG - Intergenic
974205200 4:58693656-58693678 ACTTCCAAACTCATTCCATAAGG + Intergenic
974292648 4:59952821-59952843 ACTTCCAATCTCATTCTATGAGG + Intergenic
974337303 4:60566167-60566189 ACTTCCAAACTCATTCTGTGAGG - Intergenic
974677051 4:65105314-65105336 ACTTCCAAACTCATTCCATGAGG + Intergenic
975027128 4:69563843-69563865 ACTTCCAAACTCATTCTATGGGG + Intergenic
975375701 4:73642360-73642382 ACTTCCAAACTCATTCTATGAGG - Intergenic
975501995 4:75096910-75096932 ACTTCCAAACTCATTCTATGAGG - Intergenic
975674904 4:76817046-76817068 ACTTCCAAACTCATTCTGTGAGG - Intergenic
975927773 4:79479182-79479204 ACTTCCAAGCTCATTCTATGAGG - Intergenic
975949477 4:79751292-79751314 ACTTCCAAACTCATTCTCTGAGG + Intergenic
976519595 4:86010960-86010982 AATTCAAATTTCACTCCGTGGGG - Intergenic
976762430 4:88564297-88564319 ACTTCCAAACTCATTCTGTGAGG - Intronic
976908513 4:90270151-90270173 ACTTCCAAACTCATTCTGTAAGG + Intronic
976909672 4:90286144-90286166 ATTTCCAAACTCATTCCATGGGG - Intronic
977381071 4:96274341-96274363 ACTTCCAAACTCATTCTATGAGG + Intergenic
977522051 4:98097104-98097126 ACTTCCAAACTCATTCTATGAGG + Intronic
978032746 4:103955836-103955858 ACTTCCAAACTCATTCTATGAGG + Intergenic
978035778 4:103991990-103992012 ACTTCCAAACTCATTCAATGAGG - Intergenic
979122208 4:116918104-116918126 AATTCCAAACTCATTCTGTGAGG - Intergenic
979184792 4:117774321-117774343 ATTTCCAAACTCACTCTATGAGG + Intergenic
979212975 4:118128695-118128717 ACTTCTAAGCTCATTCTATGAGG - Intronic
979638341 4:122982497-122982519 ACTTCCAAACTCACTTTATGAGG - Intronic
980753089 4:137118006-137118028 ACTTCCAAACTCATTCTATGAGG + Intergenic
980956221 4:139431810-139431832 ACTTCCAAACTCATTCTATGAGG - Intergenic
981111902 4:140944409-140944431 ACATCCAGGCTCACTCTGGGGGG + Intronic
981154707 4:141420518-141420540 ACTTCCAAACTCATTCTATGAGG - Intergenic
981837281 4:149068984-149069006 ACTTCCAAACTCATTCTATGAGG + Intergenic
981884820 4:149661463-149661485 ACTTTCAAGCTCATTTTGTGAGG - Intergenic
982910869 4:161141153-161141175 ACTTCCAAACTCACTCTATAAGG + Intergenic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
983456611 4:167972746-167972768 ACTTCCATACTCATTCCATGAGG + Intergenic
983663011 4:170150160-170150182 ACTTCCAAACTCACTTTATGAGG - Intergenic
984222741 4:176997450-176997472 ACTTCCAAGCTCATTCTCTGAGG + Intergenic
984529368 4:180897461-180897483 ACTTCCAAACTCATTCTATGAGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985989787 5:3546243-3546265 ACTTCCAAGCTCTTTGCATGTGG - Intergenic
986899007 5:12408701-12408723 ACGTCCAAGCTCATTCTATGAGG - Intergenic
987631791 5:20482415-20482437 ACTTCCAAACTCATTCTATGAGG + Intronic
988384478 5:30543137-30543159 ACTTCCAAACTCATTCTATGAGG + Intergenic
989330150 5:40248418-40248440 ACTTCCAAACTCATTCTATGAGG + Intergenic
989428151 5:41320242-41320264 ATTTCCAAACTCACTCTATGAGG + Intronic
990800197 5:59593521-59593543 ACTTCCAAGCTCCTTATGTGAGG - Intronic
991205608 5:64046586-64046608 ACTTCCAAACTCATTCTATGGGG + Intergenic
991238026 5:64421763-64421785 ACTTCCAAACCCATTCTGTGAGG + Intergenic
991296556 5:65087480-65087502 AATTGCAAACTCACTCTGTGTGG - Intergenic
991693142 5:69245185-69245207 ACTTCCAAACTCATTCTATGGGG - Intronic
992264332 5:75003335-75003357 ACTTCCAAGCTCTGTACATGTGG + Intergenic
992309883 5:75485985-75486007 ACTTCCAAACTCATTCTATGAGG + Intronic
992726242 5:79610396-79610418 ACTTCCCAGCTCATTCTGTGGGG - Intergenic
993206753 5:84891425-84891447 ACTTCCAAACTCATTCTATGAGG - Intergenic
993308664 5:86300500-86300522 ACTTCCCAGCTTATTCTGTGAGG + Intergenic
993421581 5:87708355-87708377 ACTTCCTTGCTCACTCCATTTGG + Intergenic
993811300 5:92480445-92480467 ACTTCCTAACTCATTCTGTGAGG + Intergenic
994428381 5:99624011-99624033 ACTTCCAAACTCATTCTATGAGG - Intergenic
995171695 5:109121601-109121623 ACTTCCCAACTCATTCCATGAGG - Intronic
995377513 5:111492773-111492795 ACTACAAAGCTCACTCCTGGAGG - Exonic
996133034 5:119805302-119805324 ACTTCCAAACTCATTCTGTGAGG - Intergenic
997180243 5:131820534-131820556 ACTTCCAAATTCATTCTGTGAGG - Intronic
999186804 5:149716927-149716949 ACTTCCCACCTCAGTCTGTGAGG - Intergenic
999188867 5:149731726-149731748 GCTTGCAAGCTGACTCCTTGCGG + Intronic
1000990053 5:167902510-167902532 ACTTCCTAACTCACTTCCTGGGG + Intronic
1001301610 5:170537672-170537694 ACTCCCAGGCTCCCTCCCTGAGG + Intronic
1002609902 5:180409934-180409956 ACTTCTGAACTCACTCTGTGAGG + Intergenic
1002678691 5:180941428-180941450 TCTTCCAAACTCATTCCATGAGG + Intronic
1003590737 6:7434542-7434564 ACCTCCAATCAGACTCCGTGTGG - Intergenic
1003775505 6:9357572-9357594 ACTTCCAAACTCATTCTATGAGG + Intergenic
1003819551 6:9881082-9881104 ACTTCCAAACTCATTTCCTGAGG + Intronic
1004491190 6:16117911-16117933 ACTTCCCAGCTCATTCAGTGAGG + Intergenic
1005978405 6:30817452-30817474 GCTGCCAAGCTCACTTCGGGAGG + Intergenic
1006777611 6:36608064-36608086 TCTTCCAACCTCACTCTTTGAGG - Intergenic
1008383604 6:50861646-50861668 ACTACCAAGCACACACAGTGTGG + Intergenic
1008800050 6:55356229-55356251 ACTTCCAAACTCATTCTTTGAGG - Intronic
1008820169 6:55622768-55622790 ATTTCCAAACTCACTCTGTGAGG - Intergenic
1009266176 6:61557643-61557665 ACTTCCAAACTCACTCTATGAGG - Intergenic
1009373227 6:62934706-62934728 ACTTCCAAATTCATTCTGTGAGG - Intergenic
1009559832 6:65225058-65225080 ACTTTCTAGCTCATTCTGTGAGG + Intronic
1010548354 6:77187414-77187436 ACTTCCAAGCTCATTCTCTGAGG + Intergenic
1010557659 6:77304311-77304333 ACTTCCAAACTCATTCTATGAGG - Intergenic
1010775847 6:79884520-79884542 ACTTCCAAACTCACTCTGTGAGG + Intergenic
1010871019 6:81039523-81039545 ACTTCCAAGCTCATTCTATGTGG + Intergenic
1010877197 6:81121259-81121281 ACTTCCAAGCTCCTTACATGTGG + Intergenic
1011095226 6:83654396-83654418 ACTTCTAAGCTCCTTCCATGTGG + Intronic
1011225806 6:85105052-85105074 ACTTCCAAACTCATTCTATGAGG - Intergenic
1011236332 6:85222076-85222098 ACTTCCAAACTCATTCTATGAGG + Intergenic
1011369771 6:86623439-86623461 ATTTCCAAACTCACTCTATGAGG - Intergenic
1011920036 6:92562687-92562709 ACTTCCAAACGCATTCTGTGAGG - Intergenic
1012096348 6:94967580-94967602 CCTTCCTAACTCACTCTGTGAGG + Intergenic
1012297542 6:97543903-97543925 ACTTCCAAACTCATTCTATGAGG - Intergenic
1012664843 6:101955208-101955230 ACTTTCCAACTCACTCCATGAGG - Intronic
1013083706 6:106836251-106836273 ACTTCCAAACTCATTCTATGAGG - Intergenic
1013909495 6:115256747-115256769 ACTTCCAAACTCATTCTGTAAGG + Intergenic
1014093236 6:117429500-117429522 ACTTCCAAACTCATTCTATGAGG - Intronic
1014928803 6:127308130-127308152 ACTTCCGAACTCATTCTGTGAGG + Intronic
1014950701 6:127551547-127551569 ACTTCCAAACTCATTCTGTGAGG + Intronic
1015907442 6:138131398-138131420 ACTTCCAAACTCATCCCATGAGG - Intergenic
1015986987 6:138894359-138894381 ACTTCCAAGCTCTTTACATGTGG + Intronic
1016347667 6:143131696-143131718 ACTTCCAAGCTCATTCAGGTTGG - Intronic
1016650911 6:146458970-146458992 ACTTCCAAACTCATTCTATGAGG - Intergenic
1017387785 6:153906323-153906345 ACTTCCAAACTCATTCTGTGAGG + Intergenic
1017400018 6:154050011-154050033 ACATCCAAACTCATTCTGTGAGG - Intronic
1018168231 6:161120771-161120793 ATTTCCAAACTCACTCTGTGAGG - Intergenic
1018536154 6:164822128-164822150 ACTTCCAAACTCATTCTATGAGG + Intergenic
1018586233 6:165362698-165362720 ACTTCCCAGCTAATTCCATGAGG + Intronic
1018608474 6:165623651-165623673 ACTTCAATGCTCACACTGTGGGG + Intronic
1019044767 6:169136138-169136160 ACTTCCAAATTCATTCCATGAGG + Intergenic
1020223222 7:6257914-6257936 ATTTCCAAGCCCACACCCTGAGG - Intronic
1021078891 7:16339178-16339200 ACTTCCCAACTCATTCTGTGAGG + Intronic
1021529274 7:21625045-21625067 ACTTCCAAACTCACTTTATGAGG - Intronic
1021746622 7:23747181-23747203 ACTTCCAAACTCATTCCATGAGG - Intronic
1021771635 7:24008263-24008285 ACTTCCAAACTCATTCTATGAGG - Intergenic
1022740766 7:33118858-33118880 ACTTCCAAACTCATTCTATGAGG - Intergenic
1023172608 7:37404282-37404304 CCTTCCACCTTCACTCCGTGTGG + Intronic
1023645506 7:42309215-42309237 ACTTCCAAATTCACTCTATGAGG + Intergenic
1023716504 7:43049665-43049687 ACTTCCAAACTCATTCTATGAGG + Intergenic
1024368753 7:48555339-48555361 ACTTCCAAACTCAATCTATGAGG - Intronic
1024526788 7:50355937-50355959 ACTTCCACGCTCCTTCAGTGGGG + Intronic
1024621869 7:51166585-51166607 ACTTCCAAACTCATTCTATGAGG + Intronic
1024660879 7:51493189-51493211 ACTTCCAAACTCATTCTATGAGG - Intergenic
1027524476 7:79249780-79249802 ACTTCCAAACTCATTCTATGAGG + Intronic
1028009657 7:85625329-85625351 ACTTCCAAACTCATTCTATGAGG - Intergenic
1029403954 7:100362188-100362210 ACTTCCAGGTTCATTCTGTGAGG + Intronic
1029408705 7:100394305-100394327 GCTTCCAAGCTTATTCTGTGAGG + Intronic
1031545408 7:123046094-123046116 ACTTCCAAACTCATTCTATGAGG - Intergenic
1031658134 7:124384105-124384127 ACTTCCAAACTCATTCTATGAGG + Intergenic
1031892587 7:127311934-127311956 ACTTCCAAACTCCTTCTGTGAGG + Intergenic
1032939517 7:136772578-136772600 ACTTCCATACTCATTCTGTGAGG + Intergenic
1033468428 7:141620384-141620406 ACTTCCAAGCTCCTTACATGTGG - Intronic
1034521176 7:151621212-151621234 ACTTCCCAGCTCCTTCCGTAAGG - Intronic
1035023502 7:155812142-155812164 ACTTCCGAGCTGTCCCCGTGCGG + Exonic
1035078784 7:156199259-156199281 ACATCCTAGATCAGTCCGTGTGG + Intergenic
1035084205 7:156243060-156243082 ACTTCCAAGCTCATTCTATGAGG - Intergenic
1036009415 8:4704795-4704817 ACTTCCAAGCTCACTCAGGCTGG - Intronic
1037254533 8:16938538-16938560 ACTTCCAAACTCATTCCATAAGG + Intergenic
1038483161 8:27915366-27915388 ACTTCCCAGCAGAGTCCGTGTGG + Intronic
1038688505 8:29740281-29740303 TCATCCAATCTCCCTCCGTGGGG - Intergenic
1039002005 8:32991692-32991714 ACTTCCAAACTCATTCTATGAGG - Intergenic
1039033912 8:33338379-33338401 ACTTCCAAACTCATTCTATGAGG + Intergenic
1040442917 8:47463506-47463528 ACTTCCTAACTCATTCCCTGAGG + Intronic
1041297965 8:56380080-56380102 ACTTCCCAACTCACTCTATGAGG - Intergenic
1041607123 8:59794485-59794507 ACTTCCAAACTCATTCTGCGAGG + Intergenic
1041823567 8:62066396-62066418 ACTTCCAAACTCATTCTATGTGG + Intergenic
1041883042 8:62774912-62774934 ACTTCCAAATTCATTCCATGAGG - Intronic
1042898766 8:73699801-73699823 GCTTCCAAACTCATTCTGTGAGG + Intronic
1042901171 8:73729414-73729436 ACTTCCTAACTCACTCTTTGAGG - Intronic
1043311694 8:78868053-78868075 ACTTCCAAACTCATTCTATGAGG - Intergenic
1043945592 8:86248284-86248306 ACTTCTAAACTCACTCTATGAGG - Intronic
1044394827 8:91698888-91698910 ACTTCCAAACTCATTCTATGAGG - Intergenic
1044499928 8:92942057-92942079 ACTTCCAAACTCATTCTATGAGG + Intronic
1044776544 8:95694824-95694846 ACTTCCAAGCTAACACAGTAAGG + Intergenic
1045132861 8:99176465-99176487 ACTTCCAGAATCACTCTGTGTGG - Intronic
1045600088 8:103704476-103704498 ACTTCCAAACTCATTCTATGAGG - Intronic
1045777140 8:105818307-105818329 ACTTCCAAACTCATTCTATGAGG - Intergenic
1045991116 8:108309629-108309651 CCTTCCAAGCTCATTCTATGAGG + Intronic
1047083296 8:121488680-121488702 ACTTCCAAACTCATTCTATGAGG + Intergenic
1047936266 8:129782841-129782863 ACTTCCAAACTCATTCTATGAGG + Intronic
1048676216 8:136784452-136784474 TCTTCCAAACTCATTCTGTGAGG + Intergenic
1048952133 8:139505088-139505110 ACTTCCAAGCCCATTTCCTGGGG - Intergenic
1050059858 9:1695906-1695928 ATTTTCAAACTCACTCCATGAGG + Intergenic
1050510280 9:6387353-6387375 ACTTCCAAACTCATTCTATGAGG + Intergenic
1050578305 9:7023150-7023172 ACTTCCAAGCTCACTCCGTGAGG - Intronic
1050906123 9:11008860-11008882 ACTTCCAAACTCATTCTATGAGG - Intergenic
1051376286 9:16405728-16405750 ACTTCCAAGCTCTGTGGGTGAGG + Intergenic
1051990754 9:23149532-23149554 ACTTCCAAACTCATTCTATGAGG - Intergenic
1052375126 9:27710419-27710441 ATTTCCAAACTCATTCTGTGAGG - Intergenic
1052400613 9:27995365-27995387 ACTTCTAAACTCATTCCATGAGG + Intronic
1052402944 9:28024112-28024134 ACTTCCAAGCTCTTTACCTGTGG + Intronic
1052565927 9:30151356-30151378 ACTTCCAAACTCATTCTATGAGG - Intergenic
1052770379 9:32683293-32683315 ACTTCCAAACTCATTCTATGAGG + Intergenic
1053454392 9:38221629-38221651 ACTTCCAAACTCATTCTATGAGG - Intergenic
1056438110 9:86592813-86592835 ACTTCCAAGCTCACTCCTATGGG + Intergenic
1056669135 9:88608605-88608627 ACTTCCTAACTCACTCCATGAGG - Intergenic
1057288740 9:93784958-93784980 ACTTCCAAACTCATTCTATGAGG - Intergenic
1058218755 9:102269053-102269075 ACTTCCAATCTTATTCTGTGAGG - Intergenic
1058768131 9:108202687-108202709 ACTTCCAAACTCATTCTATGAGG + Intergenic
1060233919 9:121847784-121847806 ACTTCCTAACTCATTCTGTGAGG + Intronic
1062124762 9:134854142-134854164 ACTTCCAAACTCACTCACTGTGG + Intergenic
1186203286 X:7175761-7175783 ACTTCCTCGCTCAATCAGTGGGG + Intergenic
1187440757 X:19317384-19317406 ACTTCCAAACTCACTTTATGAGG - Intergenic
1188327964 X:28830146-28830168 ACTTCCTACCTCATTCCATGAGG - Intronic
1188348763 X:29101484-29101506 ACTTCCAAACTCACTCTACGAGG + Intronic
1189013137 X:37067229-37067251 ACTTCCAAACTCATTCGATGAGG - Intergenic
1189585044 X:42451456-42451478 ACTTCCAACCTCATTCCATGAGG + Intergenic
1189769199 X:44406087-44406109 ACTTCCAAACTCATTCAATGAGG - Intergenic
1190500872 X:51077240-51077262 TCTTCCACCCTCACTCCTTGAGG + Intergenic
1190907498 X:54741975-54741997 ACTTCCAAACTCATTCTATGAGG - Intergenic
1190964452 X:55285232-55285254 ACTTCCAAACTCATTCTATGAGG - Intronic
1191050943 X:56191441-56191463 ACTTCCAAACTTATTCCATGAGG + Intergenic
1191102228 X:56743301-56743323 ACTTCCAAACTAATTCCATGAGG - Intergenic
1191994074 X:67071608-67071630 TCTTCCAAGCTCATTCCATGAGG + Intergenic
1192088402 X:68125815-68125837 ACTTCCAAACTCACTCTACGAGG + Intronic
1192193148 X:69008129-69008151 ACTTCCTAACTCATTCTGTGAGG - Intergenic
1192353722 X:70379863-70379885 ACTTCCCAACTCATTCCATGAGG + Intronic
1192463108 X:71334938-71334960 ACTTCCTAGCTCATTCTATGAGG - Intergenic
1193013209 X:76701591-76701613 ACTTCCAAACTCATTCCATGAGG + Intergenic
1193022875 X:76810912-76810934 ACTTCGAAACTCATTCTGTGAGG + Intergenic
1193111228 X:77732419-77732441 ACTTCCAAACACATTCTGTGAGG + Intronic
1193245857 X:79228503-79228525 AGTTCCAAACTCACTCTGTGAGG - Intergenic
1193365934 X:80633257-80633279 ACTTCCAAACTCATTCTATGAGG - Intergenic
1193620112 X:83742182-83742204 ACTTCCAAACTCATTCTATGAGG + Intergenic
1193631521 X:83894218-83894240 ACTTCCAAACTCATTCTATGAGG - Intergenic
1193664847 X:84303097-84303119 ACTTCCAAACTCATTCTATGAGG + Intergenic
1193915757 X:87361329-87361351 ACTTCCAAACTCATTCTATGAGG + Intergenic
1194218446 X:91162284-91162306 ACTTCCAAACTCATTCTATGAGG - Intergenic
1194389387 X:93297448-93297470 ACTTCCAAACTTATTCTGTGAGG + Intergenic
1194431821 X:93817158-93817180 ACTTCCAAACTCATTCTATGAGG + Intergenic
1194516464 X:94861669-94861691 ACTTCCAAACTCATTCTGTAAGG + Intergenic
1194877247 X:99204439-99204461 ACTTCCAAACTCATTCTATGAGG - Intergenic
1194929686 X:99871186-99871208 ACTTCCAAACTCATTCTATGAGG + Intergenic
1194931411 X:99892171-99892193 ACTTCCAAACTCATTTTGTGAGG + Intergenic
1194953687 X:100155035-100155057 ACTTCCAAACTCCCTCTATGAGG - Intergenic
1194965414 X:100283121-100283143 ACTTCCAAACTCATTCTATGAGG - Intergenic
1195131040 X:101852525-101852547 ACTTCCAAGCTCTTTCTATGAGG + Intronic
1195455203 X:105060644-105060666 ACTTCCAAACTCATTCTATGAGG - Intronic
1195528848 X:105928001-105928023 TCTTCCAAACTCATTCTGTGAGG - Intronic
1195873336 X:109510772-109510794 ACTTCCAAACTCATTCTATGAGG + Intergenic
1196215310 X:113044099-113044121 ACTTCCAAACTCATTCTATGAGG - Intergenic
1196599652 X:117587160-117587182 ACTTTCAAACTCATTCTGTGAGG - Intergenic
1196822831 X:119716193-119716215 ACTTCCAAACTCATTCTGTGAGG + Intergenic
1197048227 X:122026385-122026407 ACTTCCAAGCTCACTATGTATGG - Intergenic
1197077844 X:122374798-122374820 GCTTCCAAACTCACTCTATGAGG - Intergenic
1197139670 X:123103136-123103158 ACTTCCAAACTCATTCTATGAGG + Intergenic
1197670210 X:129268808-129268830 ACTTCCAAGCTCATTCTCTGAGG - Intergenic
1197810698 X:130440342-130440364 ACTTCCAAACTCACTCTTCGAGG - Intergenic
1198190805 X:134303452-134303474 ACTTCCAAACTCATTCAGTTAGG + Intergenic
1199194908 X:145016835-145016857 ACTTCCAACCTCATTCTGTGAGG + Intergenic
1199304300 X:146249454-146249476 ACTTCCAACCTCATTCTATGAGG + Intergenic
1199485466 X:148342618-148342640 ACTTCCAAACTCATTCTATGAGG + Intergenic
1199740922 X:150735487-150735509 ACTTCCTAGTTCATTCCATGAGG - Intronic
1199921370 X:152407706-152407728 ACTTCCAAACTCATTCTATGAGG + Intronic
1200554958 Y:4626044-4626066 ACTTCCAAACTCATTCTATGAGG - Intergenic
1201055066 Y:9980372-9980394 AGTTCCATGCTCACTCCTGGGGG + Intergenic
1201067694 Y:10114735-10114757 ACTTCCAAACTCATTCTTTGAGG + Intergenic