ID: 1050580176

View in Genome Browser
Species Human (GRCh38)
Location 9:7046165-7046187
Sequence TGTAGCAATTGGAGTCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050580174_1050580176 29 Left 1050580174 9:7046113-7046135 CCTGGTCTTTTTCATGAGAGTGT 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1050580176 9:7046165-7046187 TGTAGCAATTGGAGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050580176 Original CRISPR TGTAGCAATTGGAGTCATCT TGG Intronic
No off target data available for this crispr