ID: 1050585849

View in Genome Browser
Species Human (GRCh38)
Location 9:7110595-7110617
Sequence TTGGATCCACAGCCTGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050585847_1050585849 -6 Left 1050585847 9:7110578-7110600 CCTCATCCTCTACGCGCTTGGAT No data
Right 1050585849 9:7110595-7110617 TTGGATCCACAGCCTGATTATGG No data
1050585845_1050585849 -3 Left 1050585845 9:7110575-7110597 CCTCCTCATCCTCTACGCGCTTG No data
Right 1050585849 9:7110595-7110617 TTGGATCCACAGCCTGATTATGG No data
1050585843_1050585849 4 Left 1050585843 9:7110568-7110590 CCTACCACCTCCTCATCCTCTAC No data
Right 1050585849 9:7110595-7110617 TTGGATCCACAGCCTGATTATGG No data
1050585844_1050585849 0 Left 1050585844 9:7110572-7110594 CCACCTCCTCATCCTCTACGCGC No data
Right 1050585849 9:7110595-7110617 TTGGATCCACAGCCTGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050585849 Original CRISPR TTGGATCCACAGCCTGATTA TGG Intergenic
No off target data available for this crispr