ID: 1050590285

View in Genome Browser
Species Human (GRCh38)
Location 9:7153564-7153586
Sequence TTTGCAGCTGGGCCTTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050590277_1050590285 13 Left 1050590277 9:7153528-7153550 CCATCAATATGCTCCCTTCTTTT No data
Right 1050590285 9:7153564-7153586 TTTGCAGCTGGGCCTTTGCATGG No data
1050590281_1050590285 0 Left 1050590281 9:7153541-7153563 CCCTTCTTTTTGAGGAGGATGGT No data
Right 1050590285 9:7153564-7153586 TTTGCAGCTGGGCCTTTGCATGG No data
1050590282_1050590285 -1 Left 1050590282 9:7153542-7153564 CCTTCTTTTTGAGGAGGATGGTT No data
Right 1050590285 9:7153564-7153586 TTTGCAGCTGGGCCTTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050590285 Original CRISPR TTTGCAGCTGGGCCTTTGCA TGG Intergenic
No off target data available for this crispr