ID: 1050592303

View in Genome Browser
Species Human (GRCh38)
Location 9:7173360-7173382
Sequence CAGAGCACGGGGCAGGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050592291_1050592303 26 Left 1050592291 9:7173311-7173333 CCCTGAGCCAGGCAAGTATGACC No data
Right 1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG No data
1050592295_1050592303 5 Left 1050592295 9:7173332-7173354 CCAGGCCCTGCAACTGATGCCGT No data
Right 1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG No data
1050592297_1050592303 -1 Left 1050592297 9:7173338-7173360 CCTGCAACTGATGCCGTCTGAGC No data
Right 1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG No data
1050592296_1050592303 0 Left 1050592296 9:7173337-7173359 CCCTGCAACTGATGCCGTCTGAG No data
Right 1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG No data
1050592294_1050592303 19 Left 1050592294 9:7173318-7173340 CCAGGCAAGTATGACCAGGCCCT No data
Right 1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG No data
1050592292_1050592303 25 Left 1050592292 9:7173312-7173334 CCTGAGCCAGGCAAGTATGACCA No data
Right 1050592303 9:7173360-7173382 CAGAGCACGGGGCAGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050592303 Original CRISPR CAGAGCACGGGGCAGGCTTC TGG Intergenic
No off target data available for this crispr