ID: 1050592808

View in Genome Browser
Species Human (GRCh38)
Location 9:7177687-7177709
Sequence CATTACATGAAGTAATTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050592803_1050592808 16 Left 1050592803 9:7177648-7177670 CCATAAACTTGAAGCTAACCAGA No data
Right 1050592808 9:7177687-7177709 CATTACATGAAGTAATTGGTTGG No data
1050592801_1050592808 18 Left 1050592801 9:7177646-7177668 CCCCATAAACTTGAAGCTAACCA No data
Right 1050592808 9:7177687-7177709 CATTACATGAAGTAATTGGTTGG No data
1050592805_1050592808 -2 Left 1050592805 9:7177666-7177688 CCAGAGATCCTGAGGCATTCTCA No data
Right 1050592808 9:7177687-7177709 CATTACATGAAGTAATTGGTTGG No data
1050592802_1050592808 17 Left 1050592802 9:7177647-7177669 CCCATAAACTTGAAGCTAACCAG No data
Right 1050592808 9:7177687-7177709 CATTACATGAAGTAATTGGTTGG No data
1050592806_1050592808 -10 Left 1050592806 9:7177674-7177696 CCTGAGGCATTCTCATTACATGA No data
Right 1050592808 9:7177687-7177709 CATTACATGAAGTAATTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050592808 Original CRISPR CATTACATGAAGTAATTGGT TGG Intergenic
No off target data available for this crispr