ID: 1050593498

View in Genome Browser
Species Human (GRCh38)
Location 9:7183541-7183563
Sequence TAGCAAACAGCAATGGTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050593498_1050593506 23 Left 1050593498 9:7183541-7183563 CCGTCTACCATTGCTGTTTGCTA No data
Right 1050593506 9:7183587-7183609 TCCATCCCTCTGGATCAGGCAGG No data
1050593498_1050593508 24 Left 1050593498 9:7183541-7183563 CCGTCTACCATTGCTGTTTGCTA No data
Right 1050593508 9:7183588-7183610 CCATCCCTCTGGATCAGGCAGGG No data
1050593498_1050593503 13 Left 1050593498 9:7183541-7183563 CCGTCTACCATTGCTGTTTGCTA No data
Right 1050593503 9:7183577-7183599 ACCACTGACTTCCATCCCTCTGG 0: 3
1: 45
2: 90
3: 116
4: 263
1050593498_1050593505 19 Left 1050593498 9:7183541-7183563 CCGTCTACCATTGCTGTTTGCTA No data
Right 1050593505 9:7183583-7183605 GACTTCCATCCCTCTGGATCAGG 0: 25
1: 61
2: 115
3: 90
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050593498 Original CRISPR TAGCAAACAGCAATGGTAGA CGG (reversed) Intergenic
No off target data available for this crispr