ID: 1050599364

View in Genome Browser
Species Human (GRCh38)
Location 9:7234991-7235013
Sequence CTGGAGATACCTGGTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050599364_1050599367 12 Left 1050599364 9:7234991-7235013 CCTTAAAAACCAGGTATCTCCAG No data
Right 1050599367 9:7235026-7235048 AATCTGCACAAGACCTCTTATGG No data
1050599364_1050599369 17 Left 1050599364 9:7234991-7235013 CCTTAAAAACCAGGTATCTCCAG No data
Right 1050599369 9:7235031-7235053 GCACAAGACCTCTTATGGGAAGG No data
1050599364_1050599370 18 Left 1050599364 9:7234991-7235013 CCTTAAAAACCAGGTATCTCCAG No data
Right 1050599370 9:7235032-7235054 CACAAGACCTCTTATGGGAAGGG No data
1050599364_1050599371 19 Left 1050599364 9:7234991-7235013 CCTTAAAAACCAGGTATCTCCAG No data
Right 1050599371 9:7235033-7235055 ACAAGACCTCTTATGGGAAGGGG No data
1050599364_1050599373 29 Left 1050599364 9:7234991-7235013 CCTTAAAAACCAGGTATCTCCAG No data
Right 1050599373 9:7235043-7235065 TTATGGGAAGGGGCATTTGCAGG No data
1050599364_1050599368 13 Left 1050599364 9:7234991-7235013 CCTTAAAAACCAGGTATCTCCAG No data
Right 1050599368 9:7235027-7235049 ATCTGCACAAGACCTCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050599364 Original CRISPR CTGGAGATACCTGGTTTTTA AGG (reversed) Intergenic
No off target data available for this crispr