ID: 1050601584

View in Genome Browser
Species Human (GRCh38)
Location 9:7258281-7258303
Sequence GCCTGTAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050601584_1050601594 29 Left 1050601584 9:7258281-7258303 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1050601594 9:7258333-7258355 TCTTAAAGCTACAGATGGGAGGG No data
1050601584_1050601593 28 Left 1050601584 9:7258281-7258303 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601584_1050601591 24 Left 1050601584 9:7258281-7258303 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1050601591 9:7258328-7258350 GAGATTCTTAAAGCTACAGATGG No data
1050601584_1050601595 30 Left 1050601584 9:7258281-7258303 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1050601595 9:7258334-7258356 CTTAAAGCTACAGATGGGAGGGG No data
1050601584_1050601592 25 Left 1050601584 9:7258281-7258303 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1050601592 9:7258329-7258351 AGATTCTTAAAGCTACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050601584 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr