ID: 1050601585

View in Genome Browser
Species Human (GRCh38)
Location 9:7258282-7258304
Sequence TGCCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 960678
Summary {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050601585_1050601594 28 Left 1050601585 9:7258282-7258304 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1050601594 9:7258333-7258355 TCTTAAAGCTACAGATGGGAGGG No data
1050601585_1050601591 23 Left 1050601585 9:7258282-7258304 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1050601591 9:7258328-7258350 GAGATTCTTAAAGCTACAGATGG No data
1050601585_1050601595 29 Left 1050601585 9:7258282-7258304 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1050601595 9:7258334-7258356 CTTAAAGCTACAGATGGGAGGGG No data
1050601585_1050601593 27 Left 1050601585 9:7258282-7258304 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601585_1050601592 24 Left 1050601585 9:7258282-7258304 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1050601592 9:7258329-7258351 AGATTCTTAAAGCTACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050601585 Original CRISPR TGCCTGTAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr