ID: 1050601586

View in Genome Browser
Species Human (GRCh38)
Location 9:7258309-7258331
Sequence TCTCTTGTGGTGGGAATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050601586_1050601600 21 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601600 9:7258353-7258375 GGGGCTGGGGCGGTCAGAGAAGG No data
1050601586_1050601594 1 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601594 9:7258333-7258355 TCTTAAAGCTACAGATGGGAGGG No data
1050601586_1050601593 0 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601586_1050601595 2 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601595 9:7258334-7258356 CTTAAAGCTACAGATGGGAGGGG No data
1050601586_1050601599 11 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601599 9:7258343-7258365 ACAGATGGGAGGGGCTGGGGCGG No data
1050601586_1050601596 6 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601596 9:7258338-7258360 AAGCTACAGATGGGAGGGGCTGG No data
1050601586_1050601591 -4 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601591 9:7258328-7258350 GAGATTCTTAAAGCTACAGATGG No data
1050601586_1050601598 8 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601598 9:7258340-7258362 GCTACAGATGGGAGGGGCTGGGG No data
1050601586_1050601597 7 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601597 9:7258339-7258361 AGCTACAGATGGGAGGGGCTGGG No data
1050601586_1050601592 -3 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601592 9:7258329-7258351 AGATTCTTAAAGCTACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050601586 Original CRISPR TCTCTTGTGGTGGGAATTGG TGG (reversed) Intergenic
No off target data available for this crispr