ID: 1050601587

View in Genome Browser
Species Human (GRCh38)
Location 9:7258312-7258334
Sequence GAATCTCTTGTGGTGGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050601587_1050601591 -7 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601591 9:7258328-7258350 GAGATTCTTAAAGCTACAGATGG No data
1050601587_1050601598 5 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601598 9:7258340-7258362 GCTACAGATGGGAGGGGCTGGGG No data
1050601587_1050601595 -1 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601595 9:7258334-7258356 CTTAAAGCTACAGATGGGAGGGG No data
1050601587_1050601593 -3 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601587_1050601601 30 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601601 9:7258365-7258387 GTCAGAGAAGGCCTCACCTCTGG No data
1050601587_1050601592 -6 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601592 9:7258329-7258351 AGATTCTTAAAGCTACAGATGGG No data
1050601587_1050601599 8 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601599 9:7258343-7258365 ACAGATGGGAGGGGCTGGGGCGG No data
1050601587_1050601594 -2 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601594 9:7258333-7258355 TCTTAAAGCTACAGATGGGAGGG No data
1050601587_1050601597 4 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601597 9:7258339-7258361 AGCTACAGATGGGAGGGGCTGGG No data
1050601587_1050601596 3 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601596 9:7258338-7258360 AAGCTACAGATGGGAGGGGCTGG No data
1050601587_1050601600 18 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601600 9:7258353-7258375 GGGGCTGGGGCGGTCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050601587 Original CRISPR GAATCTCTTGTGGTGGGAAT TGG (reversed) Intergenic
No off target data available for this crispr