ID: 1050601593

View in Genome Browser
Species Human (GRCh38)
Location 9:7258332-7258354
Sequence TTCTTAAAGCTACAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050601588_1050601593 -9 Left 1050601588 9:7258318-7258340 CCCACCACAAGAGATTCTTAAAG No data
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601589_1050601593 -10 Left 1050601589 9:7258319-7258341 CCACCACAAGAGATTCTTAAAGC No data
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601587_1050601593 -3 Left 1050601587 9:7258312-7258334 CCAATTCCCACCACAAGAGATTC No data
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601585_1050601593 27 Left 1050601585 9:7258282-7258304 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601586_1050601593 0 Left 1050601586 9:7258309-7258331 CCACCAATTCCCACCACAAGAGA No data
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data
1050601584_1050601593 28 Left 1050601584 9:7258281-7258303 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1050601593 9:7258332-7258354 TTCTTAAAGCTACAGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050601593 Original CRISPR TTCTTAAAGCTACAGATGGG AGG Intergenic
No off target data available for this crispr