ID: 1050602976

View in Genome Browser
Species Human (GRCh38)
Location 9:7271551-7271573
Sequence CCTGCTAAGCAGCCAAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050602976_1050602980 -5 Left 1050602976 9:7271551-7271573 CCATGCCTTGGCTGCTTAGCAGG No data
Right 1050602980 9:7271569-7271591 GCAGGAAGAATAAGAAGTGGTGG No data
1050602976_1050602979 -8 Left 1050602976 9:7271551-7271573 CCATGCCTTGGCTGCTTAGCAGG No data
Right 1050602979 9:7271566-7271588 TTAGCAGGAAGAATAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050602976 Original CRISPR CCTGCTAAGCAGCCAAGGCA TGG (reversed) Intergenic
No off target data available for this crispr