ID: 1050605417

View in Genome Browser
Species Human (GRCh38)
Location 9:7296122-7296144
Sequence ATGTGCCCCTTTAACATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050605415_1050605417 2 Left 1050605415 9:7296097-7296119 CCTGTTATACCAGTGCAAAACAA No data
Right 1050605417 9:7296122-7296144 ATGTGCCCCTTTAACATTTGAGG No data
1050605413_1050605417 17 Left 1050605413 9:7296082-7296104 CCCAGTCTGTAGTCTCCTGTTAT No data
Right 1050605417 9:7296122-7296144 ATGTGCCCCTTTAACATTTGAGG No data
1050605414_1050605417 16 Left 1050605414 9:7296083-7296105 CCAGTCTGTAGTCTCCTGTTATA No data
Right 1050605417 9:7296122-7296144 ATGTGCCCCTTTAACATTTGAGG No data
1050605416_1050605417 -7 Left 1050605416 9:7296106-7296128 CCAGTGCAAAACAAAGATGTGCC No data
Right 1050605417 9:7296122-7296144 ATGTGCCCCTTTAACATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050605417 Original CRISPR ATGTGCCCCTTTAACATTTG AGG Intergenic
No off target data available for this crispr