ID: 1050607151

View in Genome Browser
Species Human (GRCh38)
Location 9:7314234-7314256
Sequence GCAATGGTGTTAGTGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050607142_1050607151 9 Left 1050607142 9:7314202-7314224 CCAGTTCTTGGGCCCCAGGGTGG No data
Right 1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG No data
1050607146_1050607151 -4 Left 1050607146 9:7314215-7314237 CCCAGGGTGGCGTATGCTGGCAA No data
Right 1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG No data
1050607147_1050607151 -5 Left 1050607147 9:7314216-7314238 CCAGGGTGGCGTATGCTGGCAAT No data
Right 1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG No data
1050607145_1050607151 -3 Left 1050607145 9:7314214-7314236 CCCCAGGGTGGCGTATGCTGGCA No data
Right 1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050607151 Original CRISPR GCAATGGTGTTAGTGGGTCC AGG Intergenic
No off target data available for this crispr