ID: 1050607545

View in Genome Browser
Species Human (GRCh38)
Location 9:7317227-7317249
Sequence CGGGTTGGTATAGTGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050607545_1050607550 13 Left 1050607545 9:7317227-7317249 CCATCAAACACTATACCAACCCG No data
Right 1050607550 9:7317263-7317285 TTCAAATTTTAGGCCAATGTTGG No data
1050607545_1050607549 3 Left 1050607545 9:7317227-7317249 CCATCAAACACTATACCAACCCG No data
Right 1050607549 9:7317253-7317275 TCTGACTTCTTTCAAATTTTAGG No data
1050607545_1050607551 25 Left 1050607545 9:7317227-7317249 CCATCAAACACTATACCAACCCG No data
Right 1050607551 9:7317275-7317297 GCCAATGTTGGTTCCGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050607545 Original CRISPR CGGGTTGGTATAGTGTTTGA TGG (reversed) Intergenic
No off target data available for this crispr