ID: 1050612039

View in Genome Browser
Species Human (GRCh38)
Location 9:7362872-7362894
Sequence GCATTTTATGGCATGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050612039_1050612044 -8 Left 1050612039 9:7362872-7362894 CCTCCAAACATGCCATAAAATGC No data
Right 1050612044 9:7362887-7362909 TAAAATGCCAATCCAGGAGGAGG No data
1050612039_1050612045 -7 Left 1050612039 9:7362872-7362894 CCTCCAAACATGCCATAAAATGC No data
Right 1050612045 9:7362888-7362910 AAAATGCCAATCCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050612039 Original CRISPR GCATTTTATGGCATGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr