ID: 1050614531

View in Genome Browser
Species Human (GRCh38)
Location 9:7388241-7388263
Sequence CAGGATCAACTGGCAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050614531_1050614538 30 Left 1050614531 9:7388241-7388263 CCACCCTCTGCCAGTTGATCCTG No data
Right 1050614538 9:7388294-7388316 TTTGCCCTGCTGTAAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050614531 Original CRISPR CAGGATCAACTGGCAGAGGG TGG (reversed) Intergenic
No off target data available for this crispr