ID: 1050616154

View in Genome Browser
Species Human (GRCh38)
Location 9:7403750-7403772
Sequence ATCTAGTCCTTGAGTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050616154_1050616158 24 Left 1050616154 9:7403750-7403772 CCATCTTTACTCAAGGACTAGAT No data
Right 1050616158 9:7403797-7403819 TAATTCACATTTTTACTTTCGGG No data
1050616154_1050616159 25 Left 1050616154 9:7403750-7403772 CCATCTTTACTCAAGGACTAGAT No data
Right 1050616159 9:7403798-7403820 AATTCACATTTTTACTTTCGGGG No data
1050616154_1050616157 23 Left 1050616154 9:7403750-7403772 CCATCTTTACTCAAGGACTAGAT No data
Right 1050616157 9:7403796-7403818 TTAATTCACATTTTTACTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050616154 Original CRISPR ATCTAGTCCTTGAGTAAAGA TGG (reversed) Intergenic
No off target data available for this crispr