ID: 1050616592

View in Genome Browser
Species Human (GRCh38)
Location 9:7407657-7407679
Sequence CTTCCATATCAGTCAGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050616587_1050616592 25 Left 1050616587 9:7407609-7407631 CCTTGACGTGGATGAAAAGCTTG No data
Right 1050616592 9:7407657-7407679 CTTCCATATCAGTCAGGGTAGGG No data
1050616586_1050616592 26 Left 1050616586 9:7407608-7407630 CCCTTGACGTGGATGAAAAGCTT No data
Right 1050616592 9:7407657-7407679 CTTCCATATCAGTCAGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050616592 Original CRISPR CTTCCATATCAGTCAGGGTA GGG Intergenic
No off target data available for this crispr