ID: 1050617232

View in Genome Browser
Species Human (GRCh38)
Location 9:7414440-7414462
Sequence AGTAGAAAAGAGGTGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050617227_1050617232 13 Left 1050617227 9:7414404-7414426 CCATCAGTGTACTAAACCTTTCA No data
Right 1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG No data
1050617224_1050617232 24 Left 1050617224 9:7414393-7414415 CCTGCCTCCATCCATCAGTGTAC No data
Right 1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG No data
1050617226_1050617232 17 Left 1050617226 9:7414400-7414422 CCATCCATCAGTGTACTAAACCT No data
Right 1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG No data
1050617225_1050617232 20 Left 1050617225 9:7414397-7414419 CCTCCATCCATCAGTGTACTAAA No data
Right 1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG No data
1050617223_1050617232 25 Left 1050617223 9:7414392-7414414 CCCTGCCTCCATCCATCAGTGTA No data
Right 1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG No data
1050617229_1050617232 -3 Left 1050617229 9:7414420-7414442 CCTTTCACTTTGAGAAGGCTAGT No data
Right 1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG No data
1050617222_1050617232 29 Left 1050617222 9:7414388-7414410 CCTGCCCTGCCTCCATCCATCAG No data
Right 1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050617232 Original CRISPR AGTAGAAAAGAGGTGGTAGA TGG Intergenic
No off target data available for this crispr