ID: 1050620434

View in Genome Browser
Species Human (GRCh38)
Location 9:7446688-7446710
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050620434_1050620439 30 Left 1050620434 9:7446688-7446710 CCCTGTAGATATTGGAGATCACA No data
Right 1050620439 9:7446741-7446763 ACTTGTCCCTTCTTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050620434 Original CRISPR TGTGATCTCCAATATCTACA GGG (reversed) Intergenic
No off target data available for this crispr