ID: 1050624762

View in Genome Browser
Species Human (GRCh38)
Location 9:7491110-7491132
Sequence GGTCCCCAACAACCAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050624760_1050624762 -8 Left 1050624760 9:7491095-7491117 CCCTAATGATACACAGGTCCCCA No data
Right 1050624762 9:7491110-7491132 GGTCCCCAACAACCAGAAGAAGG No data
1050624761_1050624762 -9 Left 1050624761 9:7491096-7491118 CCTAATGATACACAGGTCCCCAA No data
Right 1050624762 9:7491110-7491132 GGTCCCCAACAACCAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050624762 Original CRISPR GGTCCCCAACAACCAGAAGA AGG Intergenic
No off target data available for this crispr