ID: 1050635399

View in Genome Browser
Species Human (GRCh38)
Location 9:7607062-7607084
Sequence GTGCCACACCCAGGATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050635399_1050635402 16 Left 1050635399 9:7607062-7607084 CCATGTGATCCTGGGTGTGGCAC No data
Right 1050635402 9:7607101-7607123 TTCTATAAAGACGATAAAAATGG No data
1050635399_1050635404 30 Left 1050635399 9:7607062-7607084 CCATGTGATCCTGGGTGTGGCAC No data
Right 1050635404 9:7607115-7607137 TAAAAATGGTGCCTAGCTATGGG No data
1050635399_1050635403 29 Left 1050635399 9:7607062-7607084 CCATGTGATCCTGGGTGTGGCAC No data
Right 1050635403 9:7607114-7607136 ATAAAAATGGTGCCTAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050635399 Original CRISPR GTGCCACACCCAGGATCACA TGG (reversed) Intergenic
No off target data available for this crispr