ID: 1050648939

View in Genome Browser
Species Human (GRCh38)
Location 9:7754397-7754419
Sequence CACTGTGCCCAGGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050648932_1050648939 -4 Left 1050648932 9:7754378-7754400 CCTGGGAGGTATAGTCCCCCACT No data
Right 1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050648939 Original CRISPR CACTGTGCCCAGGAGGAAGA AGG Intergenic
No off target data available for this crispr