ID: 1050658701

View in Genome Browser
Species Human (GRCh38)
Location 9:7858802-7858824
Sequence ATAAAGAAACAGTGTGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050658698_1050658701 1 Left 1050658698 9:7858778-7858800 CCATCTAGTAGGTAGGGGAAGCC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG No data
1050658693_1050658701 15 Left 1050658693 9:7858764-7858786 CCTTGAAGAAGATACCATCTAGT 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050658701 Original CRISPR ATAAAGAAACAGTGTGATTA GGG Intronic
No off target data available for this crispr