ID: 1050660210

View in Genome Browser
Species Human (GRCh38)
Location 9:7876197-7876219
Sequence CAAAATGCTTATAGTAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050660207_1050660210 4 Left 1050660207 9:7876170-7876192 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050660210 Original CRISPR CAAAATGCTTATAGTAATAT GGG Intronic
No off target data available for this crispr