ID: 1050668613

View in Genome Browser
Species Human (GRCh38)
Location 9:7969882-7969904
Sequence ACCAAAAATGTCTCTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050668613_1050668618 10 Left 1050668613 9:7969882-7969904 CCATGTCCAGAGACATTTTTGGT No data
Right 1050668618 9:7969915-7969937 CGGGTAGTGGTACTATAAGCAGG No data
1050668613_1050668616 -9 Left 1050668613 9:7969882-7969904 CCATGTCCAGAGACATTTTTGGT No data
Right 1050668616 9:7969896-7969918 ATTTTTGGTTTTCACAACTCGGG No data
1050668613_1050668620 21 Left 1050668613 9:7969882-7969904 CCATGTCCAGAGACATTTTTGGT No data
Right 1050668620 9:7969926-7969948 ACTATAAGCAGGATCTAGGCAGG No data
1050668613_1050668619 17 Left 1050668613 9:7969882-7969904 CCATGTCCAGAGACATTTTTGGT No data
Right 1050668619 9:7969922-7969944 TGGTACTATAAGCAGGATCTAGG No data
1050668613_1050668621 24 Left 1050668613 9:7969882-7969904 CCATGTCCAGAGACATTTTTGGT No data
Right 1050668621 9:7969929-7969951 ATAAGCAGGATCTAGGCAGGTGG No data
1050668613_1050668615 -10 Left 1050668613 9:7969882-7969904 CCATGTCCAGAGACATTTTTGGT No data
Right 1050668615 9:7969895-7969917 CATTTTTGGTTTTCACAACTCGG 0: 12
1: 147
2: 530
3: 861
4: 1426
1050668613_1050668617 -3 Left 1050668613 9:7969882-7969904 CCATGTCCAGAGACATTTTTGGT No data
Right 1050668617 9:7969902-7969924 GGTTTTCACAACTCGGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050668613 Original CRISPR ACCAAAAATGTCTCTGGACA TGG (reversed) Intergenic
No off target data available for this crispr