ID: 1050674815

View in Genome Browser
Species Human (GRCh38)
Location 9:8039974-8039996
Sequence CTAAACTCTTTGTACTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050674815_1050674816 4 Left 1050674815 9:8039974-8039996 CCTATAAAGTACAAAGAGTTTAG No data
Right 1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050674815 Original CRISPR CTAAACTCTTTGTACTTTAT AGG (reversed) Intergenic
No off target data available for this crispr