ID: 1050674816

View in Genome Browser
Species Human (GRCh38)
Location 9:8040001-8040023
Sequence AAGTACTTCCAGAAGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050674814_1050674816 17 Left 1050674814 9:8039961-8039983 CCTAGCAAGAAAGCCTATAAAGT No data
Right 1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG No data
1050674815_1050674816 4 Left 1050674815 9:8039974-8039996 CCTATAAAGTACAAAGAGTTTAG No data
Right 1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050674816 Original CRISPR AAGTACTTCCAGAAGATTGA TGG Intergenic
No off target data available for this crispr