ID: 1050674816 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:8040001-8040023 |
Sequence | AAGTACTTCCAGAAGATTGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1050674814_1050674816 | 17 | Left | 1050674814 | 9:8039961-8039983 | CCTAGCAAGAAAGCCTATAAAGT | No data | ||
Right | 1050674816 | 9:8040001-8040023 | AAGTACTTCCAGAAGATTGATGG | No data | ||||
1050674815_1050674816 | 4 | Left | 1050674815 | 9:8039974-8039996 | CCTATAAAGTACAAAGAGTTTAG | No data | ||
Right | 1050674816 | 9:8040001-8040023 | AAGTACTTCCAGAAGATTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1050674816 | Original CRISPR | AAGTACTTCCAGAAGATTGA TGG | Intergenic | ||
No off target data available for this crispr |