ID: 1050687854

View in Genome Browser
Species Human (GRCh38)
Location 9:8191327-8191349
Sequence CTCACTGCTCAGCCTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050687854_1050687857 1 Left 1050687854 9:8191327-8191349 CCTCACCCAGGCTGAGCAGTGAG No data
Right 1050687857 9:8191351-8191373 TCATACCCCTCTGTACTCCATGG No data
1050687854_1050687860 7 Left 1050687854 9:8191327-8191349 CCTCACCCAGGCTGAGCAGTGAG No data
Right 1050687860 9:8191357-8191379 CCCTCTGTACTCCATGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050687854 Original CRISPR CTCACTGCTCAGCCTGGGTG AGG (reversed) Intergenic
No off target data available for this crispr