ID: 1050690400

View in Genome Browser
Species Human (GRCh38)
Location 9:8221172-8221194
Sequence AAGGAGAAGCAGGGTGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050690392_1050690400 -2 Left 1050690392 9:8221151-8221173 CCTAACGAGGTCAGGAAGACTAA No data
Right 1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG No data
1050690387_1050690400 21 Left 1050690387 9:8221128-8221150 CCCTGGGTTGATGGTACAACCTA No data
Right 1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG No data
1050690388_1050690400 20 Left 1050690388 9:8221129-8221151 CCTGGGTTGATGGTACAACCTAC No data
Right 1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG No data
1050690391_1050690400 2 Left 1050690391 9:8221147-8221169 CCTACCTAACGAGGTCAGGAAGA No data
Right 1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050690400 Original CRISPR AAGGAGAAGCAGGGTGGGGG AGG Intergenic
No off target data available for this crispr