ID: 1050693966

View in Genome Browser
Species Human (GRCh38)
Location 9:8259219-8259241
Sequence GGCAGAGCACCCAGCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050693966_1050693968 5 Left 1050693966 9:8259219-8259241 CCAGCTCAGCTGGGTGCTCTGCC No data
Right 1050693968 9:8259247-8259269 ACTGCCCTATGATCAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050693966 Original CRISPR GGCAGAGCACCCAGCTGAGC TGG (reversed) Intergenic
No off target data available for this crispr