ID: 1050694272

View in Genome Browser
Species Human (GRCh38)
Location 9:8261613-8261635
Sequence TCCAAGTAGGAGCATGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050694272_1050694278 12 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694278 9:8261648-8261670 GCAGGCCTATGTTCCCTAATAGG No data
1050694272_1050694282 24 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694282 9:8261660-8261682 TCCCTAATAGGAGTTTGCTGGGG No data
1050694272_1050694280 22 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694280 9:8261658-8261680 GTTCCCTAATAGGAGTTTGCTGG No data
1050694272_1050694276 -6 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694276 9:8261630-8261652 CTTGGAATGGGCTTCCTAGCAGG No data
1050694272_1050694281 23 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694281 9:8261659-8261681 TTCCCTAATAGGAGTTTGCTGGG No data
1050694272_1050694284 25 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694284 9:8261661-8261683 CCCTAATAGGAGTTTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050694272 Original CRISPR TCCAAGTAGGAGCATGAGAC AGG (reversed) Intergenic
No off target data available for this crispr