ID: 1050694277

View in Genome Browser
Species Human (GRCh38)
Location 9:8261644-8261666
Sequence TTAGGGAACATAGGCCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050694277_1050694286 11 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694286 9:8261678-8261700 TGGGGGTTTCTGTCACCTGAAGG No data
1050694277_1050694287 21 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694287 9:8261688-8261710 TGTCACCTGAAGGTACTGACCGG No data
1050694277_1050694280 -9 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694280 9:8261658-8261680 GTTCCCTAATAGGAGTTTGCTGG No data
1050694277_1050694282 -7 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694282 9:8261660-8261682 TCCCTAATAGGAGTTTGCTGGGG No data
1050694277_1050694289 26 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694289 9:8261693-8261715 CCTGAAGGTACTGACCGGTTAGG No data
1050694277_1050694281 -8 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694281 9:8261659-8261681 TTCCCTAATAGGAGTTTGCTGGG No data
1050694277_1050694284 -6 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694284 9:8261661-8261683 CCCTAATAGGAGTTTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050694277 Original CRISPR TTAGGGAACATAGGCCTGCT AGG (reversed) Intergenic
No off target data available for this crispr