ID: 1050694280

View in Genome Browser
Species Human (GRCh38)
Location 9:8261658-8261680
Sequence GTTCCCTAATAGGAGTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050694272_1050694280 22 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694280 9:8261658-8261680 GTTCCCTAATAGGAGTTTGCTGG No data
1050694277_1050694280 -9 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694280 9:8261658-8261680 GTTCCCTAATAGGAGTTTGCTGG No data
1050694275_1050694280 9 Left 1050694275 9:8261626-8261648 CCTACTTGGAATGGGCTTCCTAG No data
Right 1050694280 9:8261658-8261680 GTTCCCTAATAGGAGTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050694280 Original CRISPR GTTCCCTAATAGGAGTTTGC TGG Intergenic
No off target data available for this crispr