ID: 1050694282

View in Genome Browser
Species Human (GRCh38)
Location 9:8261660-8261682
Sequence TCCCTAATAGGAGTTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050694277_1050694282 -7 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694282 9:8261660-8261682 TCCCTAATAGGAGTTTGCTGGGG No data
1050694275_1050694282 11 Left 1050694275 9:8261626-8261648 CCTACTTGGAATGGGCTTCCTAG No data
Right 1050694282 9:8261660-8261682 TCCCTAATAGGAGTTTGCTGGGG No data
1050694272_1050694282 24 Left 1050694272 9:8261613-8261635 CCTGTCTCATGCTCCTACTTGGA No data
Right 1050694282 9:8261660-8261682 TCCCTAATAGGAGTTTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050694282 Original CRISPR TCCCTAATAGGAGTTTGCTG GGG Intergenic
No off target data available for this crispr