ID: 1050694289

View in Genome Browser
Species Human (GRCh38)
Location 9:8261693-8261715
Sequence CCTGAAGGTACTGACCGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050694277_1050694289 26 Left 1050694277 9:8261644-8261666 CCTAGCAGGCCTATGTTCCCTAA No data
Right 1050694289 9:8261693-8261715 CCTGAAGGTACTGACCGGTTAGG No data
1050694279_1050694289 17 Left 1050694279 9:8261653-8261675 CCTATGTTCCCTAATAGGAGTTT No data
Right 1050694289 9:8261693-8261715 CCTGAAGGTACTGACCGGTTAGG No data
1050694283_1050694289 9 Left 1050694283 9:8261661-8261683 CCCTAATAGGAGTTTGCTGGGGG No data
Right 1050694289 9:8261693-8261715 CCTGAAGGTACTGACCGGTTAGG No data
1050694285_1050694289 8 Left 1050694285 9:8261662-8261684 CCTAATAGGAGTTTGCTGGGGGT No data
Right 1050694289 9:8261693-8261715 CCTGAAGGTACTGACCGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050694289 Original CRISPR CCTGAAGGTACTGACCGGTT AGG Intergenic
No off target data available for this crispr