ID: 1050701954

View in Genome Browser
Species Human (GRCh38)
Location 9:8349974-8349996
Sequence GTCTTTCAGCTTGTAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050701954_1050701956 10 Left 1050701954 9:8349974-8349996 CCAGTGTTTACAAGCTGAAAGAC 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1050701956 9:8350007-8350029 ATTAAACAAGTATGCCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050701954 Original CRISPR GTCTTTCAGCTTGTAAACAC TGG (reversed) Intronic
905076259 1:35273136-35273158 GTCTCTCAATTTGTGAACACGGG + Intronic
908466661 1:64402774-64402796 GTCTTTCAGCATAAAAACAAGGG - Intergenic
909267598 1:73580529-73580551 GGCTCTCAGCTTGAAAATACTGG - Intergenic
909929742 1:81482677-81482699 ATCTTTATGTTTGTAAACACAGG + Intronic
912039418 1:105368813-105368835 GGCTTTCAGCTTTTAATCACTGG + Intergenic
916434538 1:164765512-164765534 GACTTTCACCTAGTAAACACAGG + Intronic
917434823 1:175009846-175009868 ATCATTCAGGTTGTTAACACTGG - Intronic
918365374 1:183802552-183802574 GTCTTTCAACCCGTAAACACGGG + Intronic
918910684 1:190564287-190564309 ATGATTCATCTTGTAAACACAGG - Intergenic
920751466 1:208681803-208681825 GTTTTTCAGCTTGTCAATTCAGG + Intergenic
922075814 1:222243438-222243460 GTCTTTCAGTTTGTAGATTCAGG - Intergenic
923891256 1:238217381-238217403 GGCTGTCAGCATGTAAACATTGG + Intergenic
1063684933 10:8227994-8228016 GTCTTTCAGAATGCAAAGACAGG + Intergenic
1065873904 10:29980762-29980784 GTTTTTTAGCTTGAAAACAATGG - Intergenic
1068205765 10:53850426-53850448 GTCATTCTTCTTGTAAACAGAGG + Intronic
1069922058 10:71821734-71821756 GTCTTTGAGTTTGTGATCACTGG - Intronic
1070805440 10:79268031-79268053 CTCTTTCAGCTCCCAAACACAGG - Intronic
1070868030 10:79721091-79721113 GTCTTCCAACTTATGAACACAGG - Intergenic
1071167521 10:82823687-82823709 ATCTTGCAGCTGGTAGACACAGG + Intronic
1071355905 10:84794649-84794671 GTCTTCCAGTCTGTGAACACAGG + Intergenic
1071634940 10:87243292-87243314 GTCTTCCAACTTATGAACACAGG - Intergenic
1071660298 10:87494704-87494726 GTCTTCCAACTTATGAACACAGG + Intergenic
1072205368 10:93199387-93199409 GTCTTTCAGCATGTGGACCCAGG - Intergenic
1075804458 10:125175525-125175547 GGCTTTCACCTTGTCACCACTGG + Intergenic
1080174204 11:29342626-29342648 GTCTTTCTGATTGTAAATCCTGG - Intergenic
1085880572 11:80462907-80462929 CTCTGTCAGCTGGAAAACACCGG - Intergenic
1087389261 11:97513585-97513607 CCCTTTCAGATTGTAAAAACAGG - Intergenic
1087487588 11:98775956-98775978 GTCTGACAGCTTGTTACCACAGG + Intergenic
1088797514 11:113276104-113276126 ATTTGTCACCTTGTAAACACTGG - Exonic
1089168897 11:116499091-116499113 GTCTTTCAGATTGTAAGGAGTGG - Intergenic
1091656919 12:2352845-2352867 GTCTTACAGATTGGCAACACTGG - Intronic
1092467885 12:8750188-8750210 GTCTTTCAGTTTTAACACACTGG + Intronic
1093065763 12:14656664-14656686 GTCATTCAGCTTCTGAAGACTGG + Intronic
1094492071 12:30966957-30966979 GTCTTTCAGCCTGTAACCTTTGG - Intronic
1095371637 12:41474505-41474527 GTCTTACAGTTTGTAAACGATGG + Intronic
1096910152 12:54975223-54975245 GTCTCTCTGCTTTTAATCACAGG - Intronic
1097553493 12:61106365-61106387 GTCATTCAGCATGTGAACACTGG + Intergenic
1098796233 12:74891672-74891694 GTTTTTCAAATTGGAAACACTGG - Intergenic
1101097649 12:101359730-101359752 GTCTTTCAGCTAGAAAACTGGGG + Intronic
1107478705 13:40766614-40766636 AAATATCAGCTTGTAAACACAGG - Intronic
1108621491 13:52189171-52189193 AAATATCAGCTTGTAAACACAGG - Intergenic
1109001413 13:56810811-56810833 TTCTTTCAACTTGTGACCACTGG - Intergenic
1111115099 13:83765426-83765448 GTCTTTCAGTTTCAAAAAACTGG + Intergenic
1115301110 14:31886618-31886640 GTCTGACAGATTGTAGACACTGG - Intergenic
1116465366 14:45225853-45225875 GTCAGTCATCTTGTAAACAATGG - Intronic
1117589583 14:57253413-57253435 GTCTTCCAGTTTGTAAACATAGG - Intronic
1120602852 14:86533384-86533406 TTCTTGCAGCATGTACACACAGG + Intergenic
1122351485 14:101096141-101096163 GTGGTTCAGCTGGTAAACATGGG - Intergenic
1123773280 15:23550702-23550724 GTCTTTCAACCTGTGAACATGGG + Intergenic
1124180375 15:27467501-27467523 GTCTTACAGCTTGTGAGTACAGG + Intronic
1126585851 15:50285829-50285851 GTCTGTCATCTTGATAACACTGG - Intronic
1127017985 15:54710136-54710158 GTCATCCAGCATTTAAACACAGG + Intergenic
1129937787 15:79465052-79465074 ATCTTTATGCTTATAAACACTGG - Intronic
1130875418 15:88009724-88009746 GATTTGCAGCTTGTAAGCACTGG + Intronic
1135349938 16:21720272-21720294 GTGTCTAAGCTAGTAAACACAGG + Intronic
1137485861 16:48890589-48890611 CTCTCACAGCTTGTAAACAGGGG - Intergenic
1146292357 17:31618146-31618168 GTCTTTCCTCTCTTAAACACAGG + Intergenic
1146387048 17:32386392-32386414 GTGTTTCAGTTTGCAATCACTGG - Intergenic
1157081221 18:44527458-44527480 GTCTTGCAGATTCTAGACACAGG + Intergenic
1164734336 19:30529739-30529761 CACTTTCAGCTTGTAGGCACGGG + Intronic
1167076255 19:47251304-47251326 GTCTTTCACTGTGTAAAGACAGG + Intergenic
1168515950 19:57010337-57010359 GTCTTTCAGCTGGTATTTACTGG - Intergenic
926384411 2:12322231-12322253 GTTTTTCAGATAGAAAACACAGG + Intergenic
929801292 2:45105393-45105415 GTCTGTCAGCATTTAAAGACTGG - Intergenic
930255988 2:49092334-49092356 GGCATTCAGATTGGAAACACAGG - Intronic
931219201 2:60274121-60274143 CTCTTTCAGCATGTAAAATCTGG + Intergenic
933288523 2:80410618-80410640 GCCTTTCAGCTTGTAGGCAAGGG + Intronic
934624627 2:95836031-95836053 CTCTGTCAGCTTGAGAACACCGG + Intergenic
934809790 2:97268971-97268993 CTCTTTCAGCATGAGAACACAGG - Intergenic
934827907 2:97439014-97439036 CTCTTTCAGCATGAGAACACAGG + Intergenic
936376227 2:111943560-111943582 GCATTTCAACATGTAAACACCGG + Intronic
939939499 2:148332639-148332661 ATCTTTCAACTTTTCAACACTGG - Intronic
941193345 2:162415231-162415253 GACTTGCAGCTGGGAAACACTGG - Intronic
942608347 2:177715084-177715106 GTCTTACTGTTTTTAAACACTGG + Intronic
948698450 2:239746009-239746031 GTGTTCCAGCTGATAAACACAGG + Intergenic
1169501545 20:6165563-6165585 GTCATTCAGCAAGTAAACAATGG + Intergenic
1170950883 20:20934894-20934916 GGCTTTCAGGTTATAAACAAGGG - Intergenic
1172328833 20:34059582-34059604 GTCATACAGCTAGTAGACACGGG + Intronic
1173030812 20:39357930-39357952 ATAGTTCAGCTTGTAAACCCAGG + Intergenic
1179000049 21:37449170-37449192 ATTTCTCAGCTTGAAAACACTGG - Intronic
1182643172 22:31785490-31785512 GTCTTTCAACCTGTGAACACAGG - Intronic
951590762 3:24261895-24261917 GTCTTGTAGCTTGTAAAGGCTGG - Intronic
951600151 3:24365313-24365335 GTCTGTCAGCTTGCAAACATGGG - Intronic
953812589 3:46127052-46127074 GTCTTCCAATCTGTAAACACAGG - Intergenic
955040754 3:55315656-55315678 GTGTTACAGCTTGAAAATACTGG + Intergenic
956565587 3:70633931-70633953 GTTTGTCAGCATGTAGACACAGG - Intergenic
957502185 3:81071225-81071247 ATGTTTCAGCGTGAAAACACTGG - Intergenic
959747269 3:109791282-109791304 GTCTTTCAGATTATACACTCAGG - Intergenic
960498904 3:118411306-118411328 GTCTTCCAGTTCGTAAACATGGG + Intergenic
962648170 3:137461171-137461193 GTCTTACAGTTAGTAAACATTGG - Intergenic
963728690 3:148949664-148949686 GACTTTAGGCTGGTAAACACTGG - Intergenic
963784894 3:149524416-149524438 TACTTTCATCTTCTAAACACTGG - Intronic
964012680 3:151909937-151909959 GTCTCTCTGATTCTAAACACAGG - Intergenic
964703510 3:159594173-159594195 TTCTTCCGCCTTGTAAACACAGG - Intronic
964808699 3:160639496-160639518 GTCTTGGAGCCTTTAAACACAGG + Intergenic
964835288 3:160931254-160931276 GTCAATCAGCTTGTGCACACAGG - Intronic
970094445 4:12446286-12446308 TTCTATCACCTTGTAAACTCAGG + Intergenic
970476350 4:16427742-16427764 GTCACCCAGCTTATAAACACAGG - Intergenic
971766041 4:30833321-30833343 CTCTTTCAGCTTCTAGACATTGG + Intronic
971969843 4:33606554-33606576 CTCTTTCAGCTAGAGAACACTGG - Intergenic
974199728 4:58622786-58622808 GTCTGTCAGCCTGAGAACACTGG - Intergenic
974461150 4:62189543-62189565 GTATATCAGATTGTTAACACAGG - Intergenic
976649958 4:87423547-87423569 TTCTTTGAGTTAGTAAACACAGG + Intronic
977092229 4:92692042-92692064 TTCTTTTAACTTGTAAATACTGG + Intronic
978439206 4:108716016-108716038 GCCTGTCAGCTTGTAGACCCAGG + Intergenic
979354946 4:119692030-119692052 GTGGTTCTGTTTGTAAACACAGG + Intergenic
980211113 4:129789199-129789221 GTTTTTCAGATTGCAAAGACTGG + Intergenic
980741745 4:136958963-136958985 TTCTTTCAACTGGTAAACAGAGG + Intergenic
982033044 4:151319960-151319982 GTCCCTCAGCTAGTAAATACTGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
985020070 4:185679411-185679433 GTCTTTCAGCTAGTAAGCTGTGG + Intronic
986969203 5:13312441-13312463 TTCTTTTAGCTTGTAAAATCTGG + Intergenic
993932627 5:93959628-93959650 TTCATTCAGATTGTGAACACAGG + Intronic
995966056 5:117909497-117909519 GTCTTTCAGCTTTCCAAAACTGG - Intergenic
996975460 5:129428206-129428228 GTTTTTCAACTCCTAAACACAGG - Intergenic
997994685 5:138576009-138576031 GTCTTTCAAGTTGTGAACAACGG - Intergenic
998657207 5:144194737-144194759 CTTTTTCAGCTGGTAAACAATGG + Intronic
1000169981 5:158692747-158692769 GTCTTCCATGTTGTAAACAAGGG - Intergenic
1003097398 6:3153785-3153807 GTCTTTCTACTTGTAAACTATGG - Exonic
1003732794 6:8844641-8844663 GTTTTACAGTTTTTAAACACAGG + Intergenic
1004573871 6:16873895-16873917 GTCTCTCAGCCTGTAACCTCAGG + Intergenic
1005665238 6:28046234-28046256 GTCTTCCAGCTTGCAGGCACTGG - Intergenic
1007208938 6:40176001-40176023 GTATTTCAGGTTGAAAACATTGG - Intergenic
1010971949 6:82272208-82272230 GTATTTCAGCTTCCAAACATTGG + Intergenic
1012191418 6:96284983-96285005 TTCATTCAACTTGTATACACAGG + Intergenic
1013174324 6:107664205-107664227 GTCTTTCAGCTGGTCAACTGGGG - Intergenic
1013820066 6:114144197-114144219 GTTTTTCAGCCTAAAAACACAGG - Intronic
1015162657 6:130170472-130170494 GTCTTTGCGATTGTAAATACTGG + Intronic
1015296864 6:131604871-131604893 GTCTTTCAGCTTTTAAGTATTGG - Intronic
1016898797 6:149080176-149080198 GGATTTCAACTTGTAAACATGGG + Intergenic
1016944589 6:149517782-149517804 GTCTTTCAGATCTTAAACTCAGG - Intronic
1018102594 6:160454370-160454392 TTCTTTCATCTTTTAAACACAGG - Intergenic
1018168167 6:161119776-161119798 GTCTTTCAGTCTGTTAACACAGG + Intergenic
1018501123 6:164411891-164411913 GTCTTACAATTTGTAAAAACTGG - Intergenic
1023037552 7:36146821-36146843 TTCTTTCATTTTTTAAACACAGG - Intergenic
1024008697 7:45248289-45248311 GTCTTTCAGATTGAAAAGAGAGG + Intergenic
1024873481 7:53993300-53993322 GACTTTCAGCTGCTAAACTCTGG - Intergenic
1026148426 7:67768311-67768333 GTCTTGCTGCTGGTAAACTCAGG - Intergenic
1028997133 7:97113270-97113292 GTTTTTCAGCTTATGAACAATGG + Intergenic
1029182687 7:98715348-98715370 TTCTTTCAGCTCATAAACACAGG + Intergenic
1033023347 7:137749574-137749596 GTCAATCAGCTTGTAGACAGAGG + Intronic
1033715765 7:144000475-144000497 GGCTTTCAGCTTGAAAGCAGTGG + Intergenic
1033857513 7:145582775-145582797 GTTTTTCAGCTGATAATCACGGG - Intergenic
1034047429 7:147944542-147944564 TTCCCTCAGCTTGTAAACATGGG - Intronic
1034241354 7:149613541-149613563 GACTTACAGTTTGGAAACACTGG + Intergenic
1037646639 8:20798388-20798410 ATCTTTCAGCTGGTTCACACAGG - Intergenic
1038046559 8:23770214-23770236 CTCTTTCAGTTTGGAAACCCAGG - Intergenic
1038641035 8:29328131-29328153 GTATTACAGTGTGTAAACACTGG - Intergenic
1038725147 8:30075569-30075591 GTCCTTCAGCTAGTAAACACAGG + Intronic
1039336263 8:36593433-36593455 GTCTTCCAACTTATGAACACAGG + Intergenic
1040562269 8:48533661-48533683 GTCATTCAATTTATAAACACAGG - Intergenic
1040753759 8:50744446-50744468 GTCTTTCAATTCATAAACACAGG - Intronic
1040922428 8:52637191-52637213 GTCTTCCAGTCAGTAAACACAGG + Intronic
1042155244 8:65838613-65838635 ATCTTTCAACTTTTAAAAACAGG + Intronic
1044944936 8:97380997-97381019 GACTTTCAGATTGTAAATGCTGG - Intergenic
1045957802 8:107929410-107929432 GGCTTTCAGCTGCTAAACAGGGG - Intronic
1047822044 8:128531552-128531574 GTCTTTCATCTTGTCAAGATTGG + Intergenic
1050701954 9:8349974-8349996 GTCTTTCAGCTTGTAAACACTGG - Intronic
1050755158 9:8993226-8993248 GGCTCACAGCTTGTAAACAGAGG - Intronic
1058349140 9:103999994-104000016 GTTTTTCATATTGTATACACAGG - Intergenic
1058857864 9:109083427-109083449 GTCTTTCAGCATGGAAAGATTGG - Intronic
1193611896 X:83642346-83642368 GTCTTTCAACTCATAAACACAGG + Intergenic
1194324055 X:92489101-92489123 GACTTCTAGCCTGTAAACACAGG + Intronic
1194862918 X:99026605-99026627 ATCTTTCAGTTAATAAACACGGG + Intergenic
1197791417 X:130257619-130257641 GTTTTTTAGCTTGAAAAAACAGG + Intronic
1199307194 X:146280122-146280144 GTCTGTCAGCTGGAGAACACTGG + Intergenic
1200334484 X:155335231-155335253 GTATTTCTGCTTGTCAACCCTGG + Intergenic
1200361450 X:155611470-155611492 GTATTTCTGCTTGTCAACCCTGG - Intronic
1200632158 Y:5602194-5602216 GACTTCTAGCCTGTAAACACAGG + Intronic