ID: 1050712552

View in Genome Browser
Species Human (GRCh38)
Location 9:8482079-8482101
Sequence GAAGTTATTAAGATTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 826
Summary {0: 1, 1: 1, 2: 7, 3: 91, 4: 726}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050712552_1050712553 1 Left 1050712552 9:8482079-8482101 CCATCTTTAATCTTAATAACTTC 0: 1
1: 1
2: 7
3: 91
4: 726
Right 1050712553 9:8482103-8482125 CTAAGCCCACACTTCTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050712552 Original CRISPR GAAGTTATTAAGATTAAAGA TGG (reversed) Intronic
900963447 1:5940490-5940512 GCAGTTATGAAGAGTAAAGCGGG - Intronic
901260715 1:7868684-7868706 GATGTTATTAACATTTATGAAGG + Intergenic
901620387 1:10580876-10580898 GTTGTTATAAAGATTAAATAAGG - Intronic
902971516 1:20055786-20055808 AACATTATGAAGATTAAAGAAGG - Intronic
903479736 1:23644517-23644539 GAAGTAATTAAGGTTAAATGAGG + Intergenic
903709257 1:25310273-25310295 GAAGTAATTAGGATTAGATAAGG + Intronic
903717862 1:25382152-25382174 GAAGTAATTAGGATTAGATAAGG - Intronic
904891559 1:33783338-33783360 GAAGTAATTAAGGTTAAATGAGG + Intronic
904894684 1:33805625-33805647 GAAGTAATTAAGGTTAAATAAGG + Intronic
905500525 1:38432949-38432971 GAAGATTTTAAGAGTAATGATGG - Intergenic
905967307 1:42109642-42109664 GAAGTAATTAAAATTAGATAAGG + Intergenic
906445230 1:45890589-45890611 GAAGTAATTAAGGTTAAATGAGG - Intronic
906469155 1:46113099-46113121 GAGGAGAATAAGATTAAAGAAGG - Intronic
906864644 1:49404190-49404212 GAAATAATTAAGATTAAATGAGG + Intronic
906929352 1:50153778-50153800 GAAGTAATTAAGGTTAAATGAGG + Intronic
907211143 1:52823791-52823813 GAAGTTATTCTGAGTAAAGAAGG - Exonic
907594508 1:55706822-55706844 GAAGTTTCTAAGATGAAACAAGG + Intergenic
908502410 1:64757353-64757375 GAAGTAATTAAGATGAAATGAGG + Intronic
908706571 1:66963472-66963494 TAAATTATAAAGATTAGAGAAGG - Intronic
909238761 1:73184567-73184589 GAACTCACTAAAATTAAAGAGGG - Intergenic
909299928 1:74000098-74000120 AATGTTATTAAGAATAAAGAGGG - Intergenic
909307016 1:74094171-74094193 GAAGTAATTAAGGTTAAATGAGG - Intronic
909320755 1:74282535-74282557 GAAGTAATTAAGTTAAAATAAGG - Intronic
909389271 1:75099927-75099949 GGAGTTATTGACATTAAAAAGGG + Intergenic
909506285 1:76393945-76393967 GAAGAAATAAAGATTCAAGAGGG + Intronic
909877089 1:80820687-80820709 TAAGTTATTAAGACAAATGAAGG - Intergenic
910016922 1:82536314-82536336 GAAGTTTCCAAGATTGAAGAAGG - Intergenic
910018685 1:82558026-82558048 GAAATGATTAAGATTAGTGAGGG + Intergenic
910469885 1:87540421-87540443 GAAGTAATTAGGATTAGATAAGG + Intergenic
911373394 1:97021937-97021959 GAAGTTATTGGGGATAAAGAAGG + Intergenic
911687888 1:100797984-100798006 GAGGTAATTAGGATTAAATAAGG + Intergenic
911809389 1:102254759-102254781 GAAGTTATCAGAAATAAAGAAGG + Intergenic
911819020 1:102392552-102392574 AAAGATTTTAAGAATAAAGATGG + Intergenic
911826585 1:102493931-102493953 GAAGTAATTAAGATTAAATAAGG - Intergenic
911884134 1:103275927-103275949 GAAGTAATTAAGATTAAGTGAGG - Intergenic
915275011 1:154782538-154782560 GAGGTAATTAAGTTTAAATAAGG - Intronic
915495181 1:156277423-156277445 GATGTAATTAGGATTAGAGAAGG - Intronic
915787138 1:158626007-158626029 GAAATTATTAATATTAAGAAGGG + Intronic
915804100 1:158826307-158826329 GAAATTAATATGATTAAAGATGG + Intergenic
915882297 1:159684843-159684865 GAGGTTCTTAAGAGTTAAGAGGG - Intergenic
916043443 1:160980973-160980995 GAGGTTATTAAGGTTAAATGAGG - Intergenic
916718294 1:167462942-167462964 GAGGCTATCAAGAGTAAAGATGG - Intronic
916894644 1:169149975-169149997 GAAGTGATTAAGAATCATGAAGG - Intronic
917143097 1:171857449-171857471 GAAGTAAATAAGTTTAGAGAGGG + Intronic
917144385 1:171872952-171872974 GTTGTTATTAAGATTGAAGGAGG + Intronic
917157305 1:172017952-172017974 AAAGTTATTAAGAGAAAAGAGGG - Intronic
917285617 1:173418974-173418996 GAGGTAATTAAGATTAAATAAGG + Intergenic
917517509 1:175720153-175720175 GAAGTAATTAAGGTTAAATGAGG + Intronic
917654226 1:177110271-177110293 TAAGTTATAAAGATCAAACAAGG + Intronic
918037232 1:180885922-180885944 GAAGCTAGTCAGAATAAAGATGG - Exonic
918436129 1:184515073-184515095 GAAGTTATGAAAATTAAATAAGG + Intronic
918623742 1:186634406-186634428 GATATTATGAGGATTAAAGAAGG + Intergenic
918891466 1:190276510-190276532 GAAGTTAGTAAGATACAATATGG - Intronic
918953809 1:191178358-191178380 GAAGTTATTGTTATTAAACATGG - Intergenic
919055469 1:192564833-192564855 GAAGTTATTAAGTAGAATGAGGG + Intergenic
920633167 1:207672268-207672290 AAAATTATTAGGAATAAAGAGGG + Intronic
920647245 1:207812645-207812667 CAAGTTATTAGGAAAAAAGAGGG + Intergenic
920715211 1:208334157-208334179 GAGGTTGTTAAAATTAAATATGG - Intergenic
920860603 1:209702764-209702786 GAAATTATTAAGAGTATACAAGG + Intronic
921226012 1:213020002-213020024 GAAATTATTAAGCTTAATGAAGG + Intergenic
921314764 1:213879923-213879945 AAAGTAATTAAGATTAAATAAGG + Intergenic
921335641 1:214082908-214082930 GAATCTATCAATATTAAAGATGG - Intergenic
921398303 1:214692693-214692715 GAAACTATAAAGAGTAAAGATGG - Intergenic
921873975 1:220173630-220173652 GAAGTTATTAGGATAAAAGGAGG - Intronic
924352632 1:243132590-243132612 GAATTTATAAAGTTTAAAAAAGG - Intronic
924897774 1:248361162-248361184 GGAGTTTTTAAGATTCCAGATGG + Intergenic
1063571909 10:7223010-7223032 GAAGTAATTAAGATAAAATGAGG - Intronic
1063745307 10:8872766-8872788 GAACTTCTTAAGTTTAAATATGG - Intergenic
1063863000 10:10332644-10332666 GAAGTGATTAGGATTAAACAAGG - Intergenic
1064354773 10:14606584-14606606 GAGGTAATTAAGGTTAAACAAGG + Intronic
1064545209 10:16443309-16443331 GAAGTAATTAAGTTAAAAGGGGG - Intronic
1064879630 10:20036226-20036248 GAAGTAATTAAGGTTAAATGAGG + Intronic
1065780895 10:29165989-29166011 GAAGTGATTAAGGTTAAATAAGG - Intergenic
1065860137 10:29865602-29865624 GAATATATAAAGATTAAATAGGG - Intergenic
1068048864 10:51923148-51923170 AAAGTTATCAGGACTAAAGAGGG - Intronic
1068180582 10:53513125-53513147 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1068527323 10:58144942-58144964 AAAGTTATTAAGGTTAAATGAGG + Intergenic
1069125813 10:64631458-64631480 GAAGTTATCCAGAATAAAGAAGG - Intergenic
1070491826 10:76983810-76983832 GAATTTATTGAGGTTACAGAAGG - Intronic
1070995797 10:80779734-80779756 GAAGTGATTAAGATAAAATGAGG - Intergenic
1071139258 10:82488550-82488572 GTAGTTATTCAGACTAAAGTTGG - Intronic
1071198611 10:83191298-83191320 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1071440296 10:85684938-85684960 GAAGTAATTGAGATTAAATGAGG - Intronic
1071741301 10:88361205-88361227 GAGGTAATTAAGATTAAATGAGG - Intronic
1071842105 10:89483233-89483255 GAAGTAATTAAGGTTGAAGGAGG - Intronic
1071852035 10:89583060-89583082 GAAGATATGGAAATTAAAGACGG + Exonic
1071858203 10:89646563-89646585 GAGGTTATTAAGAGCAAAGGTGG + Intergenic
1072341510 10:94456918-94456940 AAAGTTATCAGGAATAAAGAGGG - Intronic
1072508461 10:96093708-96093730 GAAGTAATTAAGATGAAATGAGG - Intergenic
1072565299 10:96612030-96612052 GAAGTCATGAAGTTTAAAGGAGG - Intronic
1072707581 10:97692387-97692409 GAAGTAATTAAGATTAAACGAGG - Intergenic
1072794969 10:98347596-98347618 GAAGTAATTAAGGTTAAAAAAGG + Intergenic
1072983179 10:100116835-100116857 GAGAGTATTAAGATTAAAGGAGG + Intergenic
1073162622 10:101413082-101413104 GAACTTATTAACATAAATGAGGG + Intronic
1074672359 10:115806439-115806461 GAAATTAATAAAATGAAAGAGGG + Intronic
1074951820 10:118344260-118344282 GCAGTAATTAAGGTTAAATAAGG - Intergenic
1074999505 10:118784777-118784799 GAGGTAATTAAGGTTAAATAAGG - Intergenic
1075538984 10:123296428-123296450 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1075820265 10:125301976-125301998 GAAGGAATTAAGGTTAAAGGAGG + Intergenic
1076050670 10:127330795-127330817 GAAGTCATGAATATTAATGAAGG + Intronic
1077993681 11:7434452-7434474 GAAGTTTTTAAGATCAAGGTAGG + Intronic
1078493408 11:11790875-11790897 GAAGTTATATAGCTTATAGAAGG - Intergenic
1079590291 11:22175299-22175321 GAGGTGATTAAGTTTAAATAAGG + Intergenic
1080101840 11:28468192-28468214 TAAGAAATTAAGATAAAAGAAGG - Intergenic
1080244115 11:30160200-30160222 GAAGTTTTAAAGATTAATGGAGG - Intergenic
1080728325 11:34919019-34919041 GAGGGAATTAAGGTTAAAGATGG - Intronic
1080905301 11:36539127-36539149 AAGGTAATTAAGATTAAAGGCGG + Intronic
1080976390 11:37345968-37345990 GAAAATATAAAGATAAAAGATGG + Intergenic
1081054326 11:38389009-38389031 GAAGTAATTAAGAAGAAATAAGG - Intergenic
1081285937 11:41270308-41270330 TAATTTATTTATATTAAAGAAGG + Intronic
1081351520 11:42058710-42058732 GAAGTAATTAAGATTAAATAAGG + Intergenic
1082019876 11:47523171-47523193 GAAGTTATAAATTTTAAAAAAGG + Intronic
1082207760 11:49458923-49458945 GAAGTTATAGAAATCAAAGAAGG - Intergenic
1084077190 11:66788990-66789012 GAGGTTATTAAGATTAAATGAGG - Intronic
1084109495 11:67004443-67004465 GAGGTAATTAAGGTTAAACAAGG + Intergenic
1084193801 11:67511918-67511940 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1085111692 11:73895619-73895641 TAAGTTATTAAGAAAAAAGTAGG - Intronic
1085218212 11:74850574-74850596 GAAATTCTTCAGATGAAAGAGGG + Intronic
1085725549 11:78951735-78951757 GAGGTGATTAAGATTAAATAAGG - Intronic
1086304275 11:85462864-85462886 GAAGTCATTAAGGTTAAATGAGG + Intronic
1086493814 11:87382495-87382517 GAGGCAATTAAGATTAAATAAGG - Intergenic
1086647516 11:89242815-89242837 GAAGTTATAGAAATCAAAGAAGG + Intronic
1086894297 11:92294280-92294302 GAAGTAATTAAGGTTAAATGGGG - Intergenic
1087484085 11:98739200-98739222 GAATTTATTAATATTTAAAATGG + Intergenic
1087543242 11:99547534-99547556 GAGGTTGTAAAGATTTAAGATGG + Intronic
1087724788 11:101704938-101704960 GATTTTATTAAGATGAAATAAGG - Intronic
1088163646 11:106905459-106905481 GAAGTGATTAAGGTTAAATGAGG - Intronic
1088519701 11:110682158-110682180 GAAATTAAAAAGATGAAAGATGG - Intronic
1088657325 11:112013224-112013246 GAGGTAATTAAGATTAAATGAGG - Intronic
1088901726 11:114123137-114123159 GAAGTAATTAAGGTTAAATGCGG - Intronic
1088983474 11:114885170-114885192 GAAGTTAGTGAAAATAAAGATGG + Intergenic
1089238944 11:117057942-117057964 GAAATTATTAATAGTAATGATGG - Intronic
1089859692 11:121577818-121577840 GATTTTATTAAAAGTAAAGATGG + Intronic
1090364986 11:126198189-126198211 GGAGATATTAGAATTAAAGAGGG + Intergenic
1090891256 11:130924446-130924468 GAGGTAATTAGGATTAAATAAGG - Intergenic
1091482409 12:847079-847101 GATTTAATTAAGATTAAAGGTGG + Intronic
1092067145 12:5600175-5600197 GAGGTAATTTAGATTAAATAAGG + Intronic
1092495289 12:8987267-8987289 GAAGTAATTAAGGTTAAATCAGG + Intronic
1092819940 12:12344217-12344239 GTTGGTATAAAGATTAAAGATGG - Intronic
1093064887 12:14646977-14646999 TTTGTTATGAAGATTAAAGATGG + Intronic
1093105759 12:15084998-15085020 GAAATAATTAAGATAAAATAAGG - Intergenic
1093276203 12:17130999-17131021 GAAATAATTAATATTAAAGAGGG + Intergenic
1093378456 12:18460064-18460086 AAAGTAATTAAGAAAAAAGAAGG - Intronic
1094254349 12:28404747-28404769 AAAGTTATTAAGGATAAAGAAGG - Intronic
1094713553 12:32988596-32988618 GAGGTGATAAAGATTAAAGTAGG - Intergenic
1094776358 12:33732906-33732928 GAAATTAGGAAGATTAAAAAAGG - Intergenic
1095344212 12:41130405-41130427 GAGGTTATTAAGATTAAATGAGG + Intergenic
1095350556 12:41205573-41205595 GAAGTTAGTGAGGTTAAAGGAGG - Intronic
1096120306 12:49084684-49084706 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1096141090 12:49243137-49243159 GAATTTGTTAAGATGAAATAAGG + Intronic
1097449198 12:59714929-59714951 GAGGTAATTAAGGTTAAATAAGG - Intronic
1097508902 12:60510850-60510872 GAAGATATTAAGAATAAAATTGG + Intergenic
1097780611 12:63699652-63699674 GATGTTTTAAAGATCAAAGAAGG - Intergenic
1097936524 12:65258172-65258194 GCAATTAATAAGATTATAGAGGG + Intergenic
1098023554 12:66179736-66179758 GAAGTAATTAAGGTTAAATAAGG + Intergenic
1098160668 12:67646131-67646153 GGAGTTATGAAGATTAAACATGG + Intergenic
1098163733 12:67672416-67672438 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1098176693 12:67799463-67799485 GAAGTAATTAAGATTAAATGAGG + Intergenic
1098243964 12:68497089-68497111 GCAGTTATTATGATAAATGAGGG - Intergenic
1098547401 12:71726996-71727018 GAGGTAATTAAGGTTAAATAAGG + Intergenic
1098723904 12:73938434-73938456 GATGTTATTATTGTTAAAGAGGG - Intergenic
1098741292 12:74176843-74176865 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1099662965 12:85589371-85589393 GAGGTAATTAAGGTTAAAGGAGG + Intergenic
1099786205 12:87267123-87267145 GAAGATATTTAGTTTAGAGAGGG - Intergenic
1100492051 12:95090141-95090163 GAAGATAATAAGATAAAAGCTGG + Intronic
1100594856 12:96062960-96062982 GAGGTAATTAAGATTAAATGAGG - Intergenic
1100677721 12:96886426-96886448 AAAGGAATTAAGATTACAGATGG - Intergenic
1100746297 12:97649992-97650014 GAATTTACTAATATTTAAGAAGG + Intergenic
1100749448 12:97680944-97680966 GGACTTGTTAAGATTAAAGAAGG - Intergenic
1101050389 12:100857009-100857031 GAGTTTATCAAGATTTAAGATGG + Intronic
1101178228 12:102179647-102179669 GAGGTAATTAAGATTAAATGAGG - Intronic
1101259926 12:103018728-103018750 GAAGATAAAAAGATAAAAGAAGG - Intergenic
1101649682 12:106665240-106665262 AAAGTTATCAAGGATAAAGAAGG - Intronic
1102125272 12:110475536-110475558 GAAGTATTTAAGAATAAAGAGGG - Intronic
1102135871 12:110574314-110574336 GTAGTTACAAAGATTAAATAAGG + Intronic
1102468575 12:113145501-113145523 AAAGCTATTAAGAGTAAAGCTGG - Intergenic
1103187171 12:118969027-118969049 GAAATAATTAAGATTAGAGCAGG - Intergenic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1104134787 12:125926937-125926959 CAAGTTATTAAAAATAAAAAGGG - Intergenic
1104216461 12:126738819-126738841 GAAGTAATTAAGGTTAAAGTAGG - Intergenic
1106670506 13:31899721-31899743 GAATTTATTAAGATTGTGGAAGG + Intergenic
1107160560 13:37222265-37222287 AAAGTTATCAGGGTTAAAGAGGG - Intergenic
1107402815 13:40085935-40085957 GAACTTATGAAGAGAAAAGAAGG - Intergenic
1108246808 13:48524397-48524419 GATATTATAAAGATTAAATAAGG - Intronic
1109195480 13:59373542-59373564 GCTGTTGTTAAGATTAAAGGAGG - Intergenic
1109254475 13:60062065-60062087 GAAGTAATTAAGATAAAATAGGG - Intronic
1109873283 13:68365225-68365247 GAAGTAATGAAGATTAAACGAGG - Intergenic
1109895772 13:68687211-68687233 GATGGTATTAAAATTAAATATGG + Intergenic
1110141432 13:72134915-72134937 GAAGTAATTAAGTTTAAATAGGG + Intergenic
1110203232 13:72878862-72878884 AAAGTTATCAAGGATAAAGAGGG - Intronic
1110281896 13:73703685-73703707 GAAGTTATCAAAATTAAATGAGG - Intronic
1110555078 13:76850710-76850732 GAAGGTATTAAGAAGAAAAACGG + Intergenic
1111035229 13:82663314-82663336 GAAATCAATAAGATTAAACAAGG - Intergenic
1111099555 13:83565465-83565487 GAAGAAAATAAGATAAAAGAAGG - Intergenic
1111129850 13:83961261-83961283 TACGTTTTTAATATTAAAGAAGG + Intergenic
1111457117 13:88499444-88499466 GAAGATATCAAGATAAAAAAGGG - Intergenic
1111461919 13:88556284-88556306 GAAGTAATTAAGATTAAATGAGG - Intergenic
1111666799 13:91279544-91279566 GAAATAATTAAGGTTAAAGGAGG - Intergenic
1111668442 13:91299183-91299205 GAAATGTTTCAGATTAAAGAAGG - Intergenic
1112234566 13:97623945-97623967 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1112442454 13:99434144-99434166 GAGGTGATTATGATTAAAAAAGG + Intergenic
1113027888 13:105961204-105961226 GAAGTTTTAAAGTTTAAAAAGGG + Intergenic
1114404525 14:22443664-22443686 GAAGTTATTAAGTTAAAATGAGG - Intergenic
1114585029 14:23803474-23803496 GAGGTAATTGAGATTAAAGGAGG + Intergenic
1114869329 14:26636831-26636853 GAAGCTATTCAGAATGAAGAAGG - Intergenic
1114878286 14:26750979-26751001 GAAATTATCAAGGATAAAGAAGG - Intergenic
1114889744 14:26903939-26903961 AAACATATTATGATTAAAGATGG - Intergenic
1114955158 14:27808192-27808214 GAAGTAATTAAGGTTAATTAAGG - Intergenic
1115656012 14:35444448-35444470 GAAATAATTAGGATTAAATAAGG - Intergenic
1116128503 14:40821319-40821341 GAAGTCGTTAAGATTAAATGAGG - Intergenic
1116365552 14:44058334-44058356 GAAGTAATTAAGATTAAGTGAGG - Intergenic
1116548415 14:46201851-46201873 TAATTTAATAAGAGTAAAGAAGG + Intergenic
1116811901 14:49547393-49547415 GAGGTAATTAAGATTAAATAAGG + Intergenic
1117177897 14:53164081-53164103 GAGGTCATTAAGATTAGATAAGG - Intergenic
1117211452 14:53504958-53504980 GAGGTAATTAAGATTAAATGAGG - Intergenic
1117508774 14:56428053-56428075 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1117964797 14:61195873-61195895 GAAGTAATTAAGATTAAATATGG - Intronic
1118000386 14:61517760-61517782 TAAGATATTAATGTTAAAGAGGG + Intronic
1118412580 14:65497219-65497241 GATGTTCCTAAGATGAAAGATGG + Intronic
1118706781 14:68487439-68487461 GATGTAATTAAGGTTAAACAAGG - Intronic
1118935832 14:70287322-70287344 GAAGGGATTAAGGTTGAAGATGG + Intergenic
1119058838 14:71453220-71453242 AAAGTTACTATGAATAAAGAAGG - Intronic
1119401133 14:74363140-74363162 GAAGAAATTAAGATAAAAAATGG + Intergenic
1119493002 14:75052829-75052851 GAGGTGATTAAGATTAAATGAGG - Intergenic
1119546107 14:75472630-75472652 GGAGTTATCAAGATCAAAAAAGG + Intronic
1120093648 14:80363397-80363419 GAGGTAATTAAGGTTAAATAAGG - Intronic
1120617820 14:86729818-86729840 AAAGTTATTAAGGTTAAATAGGG + Intergenic
1121555208 14:94831349-94831371 GGAGTAATTAAGGTTAAATAAGG - Intergenic
1121678032 14:95770269-95770291 GAAGTAATTAAGGTTAAACAAGG + Intergenic
1121720829 14:96107555-96107577 GAAGTAATTAAGATTAAATGAGG + Intergenic
1121882782 14:97515382-97515404 GAAGTAATTAAGATTAAACGAGG - Intergenic
1122160394 14:99780176-99780198 GAAGTAATTAAGGTTAAATGAGG - Intronic
1123452815 15:20382935-20382957 GAAGTGATCACTATTAAAGAAGG + Intergenic
1123828060 15:24103180-24103202 AAAGTTATCAGGAATAAAGAAGG - Intergenic
1123842515 15:24262594-24262616 AAAGTTATCAGGAATAAAGAAGG - Intergenic
1123852083 15:24368611-24368633 AAAGTTATCAGGAATAAAGAAGG - Intergenic
1123862180 15:24479181-24479203 AAAGTTATCAGGAATAAAGAAGG - Intergenic
1125039031 15:35161593-35161615 GAAGTAATTAAGGTTAGACAAGG + Intergenic
1127647117 15:60969895-60969917 GAAGTAATTAAGGTTAAATGTGG + Intronic
1127898026 15:63320034-63320056 AATGTTATAAAGATTAAAAATGG - Intergenic
1128197827 15:65776267-65776289 AATGGTATTAATATTAAAGAAGG + Intronic
1128419311 15:67476433-67476455 GAAGTGATTAAGGTTAAATGAGG - Intronic
1128471594 15:67958403-67958425 GAAGCAATTAACAATAAAGAGGG - Intergenic
1128883541 15:71264974-71264996 GAACTAATTAAGATTAAATGAGG + Intronic
1129051002 15:72781841-72781863 GAAGTAGTTAAGGTTAAATAAGG + Intronic
1129279049 15:74469313-74469335 GAGGTTATTAAGATTAAATGAGG - Intergenic
1129314862 15:74735740-74735762 GAAGTAATTAAGATTAGATAAGG + Intergenic
1129498538 15:76012826-76012848 GAACTTATAAAGCTAAAAGAAGG + Intronic
1129677725 15:77641503-77641525 GAAGTTATAAAGAAGAAAGCAGG + Intronic
1130241913 15:82201672-82201694 GAAGTTATTAACTATAAAAATGG - Intronic
1130458465 15:84139176-84139198 GAAGTTATTAACTATAAAAATGG + Intergenic
1130510214 15:84582984-84583006 GAAGTCATTAAGGTTAAATGAGG - Intergenic
1130581999 15:85145943-85145965 AAAGTTATCAAGGATAAAGAAGG + Intergenic
1130584867 15:85173015-85173037 GAAGTCATTAAGGTTAAATGAGG + Intergenic
1130905515 15:88237975-88237997 GAAGTAATTAAGTTTAAATGAGG + Intronic
1131091150 15:89625702-89625724 GAAGTTAGTAAGAGTAAAGAGGG + Exonic
1131265830 15:90914824-90914846 GACGTTCTTAAGAATCAAGACGG + Intronic
1131495658 15:92908680-92908702 GCAGCTATTAAGACTAAAAAGGG - Intronic
1131505947 15:93019392-93019414 GTAGTTGTTAAGATTTCAGAAGG + Intronic
1131908847 15:97173640-97173662 GAAGTAATTAAGATTAAATGAGG - Intergenic
1131986219 15:98044846-98044868 GAAGTAATTAAGATTGAAGGAGG + Intergenic
1132077449 15:98834063-98834085 GAGGATATTAAGGGTAAAGAAGG - Intronic
1132345765 15:101107835-101107857 GAGGTAATTAAGATAAAACAAGG + Intergenic
1133439446 16:5808144-5808166 GAAGTAATTAAGATAAAATGAGG + Intergenic
1133530126 16:6647568-6647590 GAAGTGATTAAGGTTAAATGAGG - Intronic
1133831332 16:9326182-9326204 GCTGCTATGAAGATTAAAGAAGG - Intergenic
1133874445 16:9720585-9720607 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1134304556 16:13020544-13020566 GAAGTCATTAAGGTTAAATGAGG - Intronic
1135829470 16:25760727-25760749 GAAGTAATTAAGGTTAAAATGGG - Intronic
1137300994 16:47147171-47147193 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1137502792 16:49024334-49024356 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1137516770 16:49151601-49151623 GAAGTTACAAAGATTAGAGCAGG + Intergenic
1138004135 16:53314922-53314944 CCAGTTATTAATCTTAAAGATGG + Exonic
1138170389 16:54844068-54844090 TAAGTTGTTAACATTGAAGATGG + Intergenic
1138824312 16:60300479-60300501 GAAGTTATTAGGCTTAGATAAGG - Intergenic
1138863882 16:60793328-60793350 GAAGTTATTAAGGTAAAATGAGG - Intergenic
1138931607 16:61665076-61665098 GAAGTAATTAAGGTTACATAAGG + Intronic
1139068412 16:63348462-63348484 AAACATATTAAGATTAAAAAGGG - Intergenic
1139451670 16:67032379-67032401 GAAGTATTAAAGGTTAAAGAAGG + Intronic
1139874213 16:70132381-70132403 GATGTTATAAACATTAAACAAGG - Intronic
1139974329 16:70796866-70796888 GAAGTAATTAAGGTTAAAAGAGG + Intronic
1140361563 16:74348764-74348786 GATGTTATAAACATTAAACAAGG + Intergenic
1140539787 16:75746328-75746350 GAAGTTATAAATATTCATGAAGG - Intronic
1140774443 16:78237197-78237219 GATGTCATTCAGATTAATGATGG + Intronic
1142270637 16:89087529-89087551 GATGTTATAAAAATTAAATAAGG - Intergenic
1142508000 17:377674-377696 GAAGTAATTAAGGTTAAATGAGG - Intronic
1143239719 17:5433712-5433734 GAAGTTATAAAGAATGATGATGG - Exonic
1143306964 17:5955129-5955151 GAAGTTATTATAATGAAAGGAGG - Intronic
1143868019 17:9938146-9938168 GAAGTAATTAAGGTTAAATGAGG + Intronic
1144116639 17:12099936-12099958 GAAGTTCATCAGATTATAGAAGG + Intronic
1145221170 17:21090140-21090162 GAAGTTATAAATATTAATGATGG + Intergenic
1145727436 17:27144101-27144123 GAAGTAATCAAGATTAGATAAGG + Intergenic
1145838561 17:27974305-27974327 GAAGTAATTAAGGTTAAATAAGG - Intergenic
1146892834 17:36517778-36517800 GAGGTAATTAAGATTAAATAAGG + Intronic
1147708852 17:42448321-42448343 GATGTAATTAAGATTAAATGAGG - Intergenic
1149855972 17:60083160-60083182 GAAACTACAAAGATTAAAGAGGG - Intergenic
1149940278 17:60856982-60857004 GAAGTTATTAAGATTTTATTAGG - Intronic
1150385398 17:64755477-64755499 CAAGTTATTGAGATTAATGTAGG - Intergenic
1151130149 17:71888704-71888726 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1151131181 17:71897608-71897630 GAAGTTATTAACATTTAAAATGG - Intergenic
1154106552 18:11528346-11528368 GAAGTAAGGTAGATTAAAGATGG + Intergenic
1155143379 18:23063633-23063655 GAAGCAATTATGATTAATGAGGG - Intergenic
1155227604 18:23743057-23743079 GGAGTGATTAAGACCAAAGATGG + Intronic
1155397184 18:25398703-25398725 GAGGTAATTAAGGTTAAATAAGG + Intergenic
1155509554 18:26562885-26562907 GAGGTAATTAAGGTTAAACAAGG - Intronic
1155684384 18:28530733-28530755 GAGGTAATTAAGAATAAACAAGG - Intergenic
1155861623 18:30908636-30908658 GAGTTTAGTAAGATGAAAGAAGG + Intergenic
1155880344 18:31140114-31140136 AAAGTTATTCAGAGTCAAGATGG - Exonic
1156265548 18:35485103-35485125 GAGGTAATTAAGATTAAATGAGG - Intronic
1156536392 18:37868696-37868718 GAAGTAATTAAGATCAAATTAGG - Intergenic
1156592641 18:38509036-38509058 GAGGTAATTAAGATTAAATGAGG - Intergenic
1156738119 18:40288411-40288433 GAAATAATAAAGATTAGAGAAGG + Intergenic
1157154436 18:45251747-45251769 GAAGTAATTAAGATAAATCAAGG - Intronic
1157502031 18:48197773-48197795 GAAGGAATTAAGATTAAGCAAGG - Intronic
1157914211 18:51648767-51648789 GAGGTAATTAAGATTAAATGAGG - Intergenic
1157991228 18:52498865-52498887 TAAGTAATTAAGGTTAAATAAGG - Intronic
1158026618 18:52905586-52905608 GAAGTCATGAAGATTCATGAAGG - Intronic
1158226189 18:55204122-55204144 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1158798811 18:60881056-60881078 GAGGTTAAAAACATTAAAGAGGG - Intergenic
1158799874 18:60893787-60893809 GAAGTAATTAAGATTAAATGAGG + Intergenic
1158841032 18:61387643-61387665 GTAGATATTTAGAATAAAGAAGG - Intronic
1159127375 18:64239408-64239430 GTTGTTCTGAAGATTAAAGATGG + Intergenic
1159544073 18:69817659-69817681 GAAGTAATTAAGGTTAAATGAGG - Intronic
1159639224 18:70844081-70844103 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1160033650 18:75282532-75282554 GAAGTAATTAACATTAAATGCGG + Intronic
1160079840 18:75714889-75714911 TAAGTAATTAAGATTAAAGGAGG - Intergenic
1163331033 19:16637919-16637941 GAGGTAATTAAGGTTAAATAAGG + Intronic
1165360136 19:35331408-35331430 GAAGTTTATAAAATTAGAGATGG + Intronic
1165405745 19:35630006-35630028 GAAATTATTAAGATGAAAATAGG + Intronic
1165526011 19:36355317-36355339 GAGGTAATTAAGGTTAAAGGAGG + Intronic
1166261076 19:41641296-41641318 GAAGTCAATAATAATAAAGATGG - Intronic
1166928048 19:46282930-46282952 GATTTTATTTAGATTAGAGATGG - Intergenic
1168479361 19:56705902-56705924 AAAGTTATCAAGATTATATAGGG + Intergenic
925510435 2:4619700-4619722 GAGGTTGTCAGGATTAAAGACGG - Intergenic
925678459 2:6391320-6391342 GAAGTGATTAAGGTTAAATGAGG + Intergenic
925760953 2:7184015-7184037 GAAGTTATTAATACCAAATATGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926213161 2:10886459-10886481 GAAGTAATTAAGGTTAAATGAGG - Intergenic
926890372 2:17634286-17634308 AAAATTATTAAGAATCAAGATGG - Intronic
926931661 2:18047153-18047175 GAAATTATTTAGGATAAAGAAGG - Intronic
927089555 2:19700233-19700255 GAAGTTTCCAAGATTAAACAGGG + Intergenic
927339776 2:21969714-21969736 GCAATAATTAAAATTAAAGAAGG + Intergenic
927376787 2:22426120-22426142 GAAGTCATGGGGATTAAAGATGG - Intergenic
928298060 2:30102514-30102536 GAGGTAATTAAGATTAAATAAGG - Intergenic
928357298 2:30630245-30630267 GAGGTAATTAAGATTAAATGAGG - Intronic
929027963 2:37623484-37623506 GAAGTAATTAGGATTAGATAAGG + Intergenic
929205878 2:39292335-39292357 GAAGTAATTAAGCTTAAATGAGG + Intronic
929269025 2:39952400-39952422 GAAGTAATTGAGATTAGATAAGG + Intergenic
929586228 2:43116480-43116502 GAAGTAATTAAGGTTAAATGAGG - Intergenic
930106558 2:47644986-47645008 GAAGTAATTAAGGTTAAATGAGG - Intergenic
930324123 2:49892408-49892430 GAAGATATTAAGATTGAGAAAGG - Intergenic
932825493 2:74935163-74935185 GAAGTAATTAAGGTTAAATGAGG + Intergenic
933132686 2:78692108-78692130 GAAGTAATAAAGGTAAAAGAGGG + Intergenic
933198361 2:79418686-79418708 CATGTTGTGAAGATTAAAGAAGG + Intronic
933594611 2:84270458-84270480 GCACTTATTAAGAATAAATAAGG - Intergenic
933629617 2:84641119-84641141 GAAGTTATAAAGAGAAAAGTGGG - Intronic
934843969 2:97649817-97649839 GAAGGAATTAAGACTACAGATGG + Intergenic
935301038 2:101694194-101694216 GAAGTAATTAAGGTTAAGCAAGG + Intergenic
935999771 2:108816137-108816159 GAATATATGAAGATTAAAAAAGG + Intronic
936260676 2:110957674-110957696 GGGGTAATTAAGATTAAAGGAGG - Intronic
936445596 2:112592228-112592250 GAGGTAATTAAGATTAGACAAGG + Intergenic
936928446 2:117761913-117761935 GAAGTAATTAAGGTTAAATGAGG - Intergenic
937420374 2:121749337-121749359 GAAGACACTAAGATTTAAGAAGG + Intronic
937488874 2:122344789-122344811 AAAGTTATAAAGATTAAGCATGG - Intergenic
937515106 2:122644593-122644615 TAAGTTATTAGTATTAAAAAAGG + Intergenic
937527315 2:122787294-122787316 GAAGTAATTAAGGTTAAATGAGG + Intergenic
937850489 2:126628577-126628599 GAAATTATCAGGAATAAAGAAGG + Intergenic
937972595 2:127562120-127562142 GAGGTAATTAAGGTTAAATAAGG - Intronic
938131680 2:128721288-128721310 GAAGTAATTAAGGTTAAATAAGG - Intergenic
938626081 2:133111049-133111071 GAGGTAATTAAGGTTAAAGGAGG - Intronic
938987216 2:136589018-136589040 GAAATGATTAAGCTTAATGAGGG - Intergenic
939072882 2:137564958-137564980 GAAGTAATTAAGGTAAAATAAGG + Intronic
939153365 2:138497942-138497964 CAAGTTATTAATATTAAACAAGG + Intergenic
939154707 2:138510657-138510679 GAAGTTATCAGGAATAAAGAGGG - Intronic
939318944 2:140590485-140590507 GAGATAATTAAGATTAAATAAGG + Intronic
939760082 2:146164451-146164473 GAAGTAATTAAAATTAGAGATGG - Intergenic
939787610 2:146537058-146537080 GAAGTAATTAAGGTAAAATAAGG + Intergenic
939869960 2:147515930-147515952 AATGTTGTGAAGATTAAAGAAGG - Intergenic
940233905 2:151488925-151488947 AAAGCTATTAAAATTAAATATGG - Intronic
940418329 2:153448886-153448908 GAAGTAATTAAGGTTAAACGAGG + Intergenic
940448168 2:153803331-153803353 GAAGTAATTAAGCTTAAATGAGG + Intergenic
940613180 2:156016430-156016452 GAAGTGATTAAGATTAAATGAGG - Intergenic
940672468 2:156687655-156687677 GAAGTAATTAAGATTAAATGAGG - Intergenic
940828579 2:158441789-158441811 GAAGATATTAATATTAAATCTGG - Intronic
940948197 2:159642972-159642994 GAAGTTATCAACATAAATGAAGG - Intergenic
941238009 2:162999541-162999563 GAATTTTGGAAGATTAAAGATGG + Intergenic
941260700 2:163292933-163292955 GAGGTAATTAAGATTAAATGAGG + Intergenic
941810691 2:169753522-169753544 GAAGTAATTAAGGTTAAATGAGG + Intronic
942326936 2:174783626-174783648 GAAGTAATTAAGGTTAAATGAGG - Intergenic
942432992 2:175935179-175935201 GAAGTTATTGAAGTTACAGATGG - Intronic
942512949 2:176722263-176722285 GAGGTAATTAAGATTAAATTAGG + Intergenic
942575776 2:177361990-177362012 GAAGGATTTAAGATTAAGGAAGG - Intronic
942826156 2:180179375-180179397 TAAGTTATTCAGATTTTAGAAGG + Intergenic
943197061 2:184766901-184766923 GAAGTAATTAAGGTTAAATGAGG + Intronic
943227628 2:185200337-185200359 AAATTTATTAAGATTTAACATGG - Intergenic
943720488 2:191198928-191198950 GAAGTAATTAAGGTTAAATGAGG - Intergenic
943898480 2:193400634-193400656 GAGGTGATTAAGATTAAATGAGG + Intergenic
943984141 2:194597081-194597103 CAAGTAATTAAGGTTAAATAAGG - Intergenic
943990844 2:194689976-194689998 GAAGTAATTAATATTAAATGAGG - Intergenic
944643169 2:201748921-201748943 GGAGTAATGGAGATTAAAGAAGG - Intronic
944758293 2:202786601-202786623 GAAGTTCTAAAGAGTCAAGAAGG + Intronic
944771499 2:202918663-202918685 GCAGTTGTCAGGATTAAAGAAGG + Intronic
944790388 2:203118942-203118964 GAATTTGTTAACATTAAAGTTGG + Intronic
944829365 2:203517244-203517266 AAAGTTATTAGGGATAAAGAAGG + Intronic
945342685 2:208675993-208676015 GAAGGAATTAAGATTGAAGCAGG - Intronic
945518443 2:210792756-210792778 ACAGTTATGAAGATTAAATAAGG + Intergenic
945899277 2:215519633-215519655 GAAGTAATTAAGATGAAATGAGG - Intergenic
947202249 2:227624494-227624516 GAAGTATTGAAGATGAAAGATGG + Intronic
947426847 2:229991387-229991409 GAAGTAATTAAGGTTAAATAAGG + Intronic
948095668 2:235332284-235332306 GAGGTAATTAAGATTAAATGAGG + Intergenic
948410547 2:237756505-237756527 GAAGTAATTAAGGTTAAATGAGG - Intronic
1168991411 20:2099081-2099103 GAGGTAATTAAGATAAAATAAGG + Intergenic
1169494458 20:6101615-6101637 GAAATTATTTAGAGTAAAAATGG - Intronic
1169646700 20:7819050-7819072 GAAGATCTTAAGAACAAAGATGG - Intergenic
1169699720 20:8432466-8432488 GAAGTAATTAAGGTTAAATAAGG - Intronic
1169701645 20:8453899-8453921 GAAGTAATTAAGGTTAAATGAGG + Intronic
1169719968 20:8665744-8665766 GAAGTTATAAAAACTAATGATGG + Intronic
1170226041 20:13992916-13992938 GAAGTAATTAAGTTTAAATGAGG - Intronic
1170419690 20:16180575-16180597 GAAGTAGTTAAGGTTAAATAAGG - Intergenic
1170636974 20:18115514-18115536 AAAGTTATAAAGGATAAAGAGGG - Intergenic
1170658074 20:18309165-18309187 GAGGTAATTAAGGTTAAATAAGG - Intronic
1172452912 20:35040895-35040917 GAAGTAATTAAGGTTAAATGAGG + Intronic
1172629882 20:36370965-36370987 GTTGTTCTGAAGATTAAAGAAGG - Intronic
1173157362 20:40625410-40625432 GAGGTAATTAAGATTAAATGAGG - Intergenic
1173573423 20:44093536-44093558 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1175254992 20:57637320-57637342 AAAGTTATCAGGAATAAAGAGGG + Intergenic
1175261024 20:57674169-57674191 GAAGTAATTAAGGTTAAAAGAGG + Intronic
1175651097 20:60723983-60724005 GAAGGGATTATCATTAAAGATGG + Intergenic
1175671880 20:60910399-60910421 GAAGTTATTAAGGTTAACTGAGG + Intergenic
1175672511 20:60917582-60917604 GAGGTAATTAAGATTAAAAGAGG + Intergenic
1176211821 20:63927678-63927700 GAAAGTATTAAAATTAAAGTTGG + Intronic
1176923471 21:14718029-14718051 GAAGTTATTAGATTTAGAGAAGG - Intergenic
1177073108 21:16535801-16535823 AAAGTTAATAAGAGTAAAGTGGG - Intergenic
1177160312 21:17540199-17540221 GAAGTGATTAAGATTAAATGAGG - Intronic
1177352910 21:19968171-19968193 AAAGTCATTAAGATTAATGTAGG + Intergenic
1177372611 21:20223194-20223216 GGAGTTATTAACATTCAAAATGG - Intergenic
1177407325 21:20686765-20686787 GAGGTTATTAAGGTTAAATGAGG + Intergenic
1177455288 21:21329994-21330016 GAGGTTATCAAGATGAGAGAGGG - Intronic
1177532658 21:22381939-22381961 AAACTTATTAAGGATAAAGAGGG + Intergenic
1177621150 21:23595486-23595508 AAAGTTGTTAGGAATAAAGAGGG + Intergenic
1177766432 21:25462751-25462773 GAGGTAATTAAGGTTAAATAAGG + Intergenic
1177807572 21:25889190-25889212 GAGGTTATTAAAGTTAAACAAGG + Intronic
1177809122 21:25905910-25905932 GAAGTTTTTAGGATTAATAATGG + Intronic
1177949038 21:27510827-27510849 GAAGTAATTAAGGTTAAAAGAGG - Intergenic
1178747287 21:35265220-35265242 GAAGTAATTAAGGTTAAAGGAGG + Intronic
1179098983 21:38339972-38339994 GAGGTAATTAAGATTAAATGAGG - Intergenic
1179174201 21:38995651-38995673 GAGGTAATTAAGATAAAAGAAGG - Intergenic
1179244475 21:39619366-39619388 GAAGTAATTAAGGTTAAATGAGG - Intronic
1179357250 21:40672141-40672163 GAAGTAATTAAGATTAAATGAGG - Intronic
1179426724 21:41285649-41285671 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1180900054 22:19364260-19364282 AAAGTTATCAAGGATAAAGAGGG + Intronic
1182233193 22:28854691-28854713 GAAGTCATTAAGGTAAAATAAGG - Intergenic
1182245503 22:28954416-28954438 GAGGTAATTAAGATTAGATAAGG - Intronic
1182384373 22:29923755-29923777 GACGTAATTAAGGTTAAATAAGG - Intronic
1182441227 22:30365501-30365523 GAAGTTGTTCAGATTGGAGAGGG + Intronic
1184129043 22:42506446-42506468 GAGGCTGTGAAGATTAAAGAGGG + Intergenic
1184138990 22:42566760-42566782 GAGGCTGTGAAGATTAAAGAGGG + Intronic
949091544 3:35027-35049 GAGGTAATTAAGATTAAACGAGG + Intergenic
949225501 3:1689041-1689063 GAACTTATGAAGATGAAAGAAGG - Intergenic
949277396 3:2300872-2300894 GATTTTATTAAAAATAAAGAAGG - Intronic
949312523 3:2715828-2715850 GAAGTAATTAAGGTTAAATGAGG - Intronic
950860230 3:16141334-16141356 GAAGTAATTAAGGTTAAATGAGG + Intergenic
951332540 3:21383962-21383984 TAAGTAATTAAGGTTAAATAAGG + Intergenic
951405103 3:22287013-22287035 GAAGTTATTAAAATATATGAAGG - Intronic
951454702 3:22877393-22877415 AATCTTATTAAGATTAAGGACGG - Intergenic
951974216 3:28485640-28485662 TTAGTTATCAAGAATAAAGAGGG - Intronic
952213751 3:31254989-31255011 GAGGTAATTAAGATTAAATGAGG - Intergenic
952837109 3:37612574-37612596 GAGGTTAATAAAAATAAAGAAGG + Intronic
954414491 3:50386493-50386515 GAAGTTGCTAAAATTAAAGCTGG - Intronic
954765995 3:52917314-52917336 GAAGTAATTAAGATTAAATGAGG + Intronic
954928646 3:54260532-54260554 GAAGTAATTAGGATTAGATAAGG - Intronic
955943905 3:64172770-64172792 GAGGTAATTAAGATTAAATGAGG + Intronic
955985931 3:64574156-64574178 CAAGTTATTTAGATTCAAAAAGG + Intronic
956001497 3:64734360-64734382 GAAGTAATTAAGATTAAATAAGG - Intergenic
956299499 3:67754690-67754712 AAAATTATTAAGGATAAAGATGG + Intergenic
957031859 3:75251250-75251272 GAGGTAATTAAGATTAAATGAGG + Intergenic
957782365 3:84835555-84835577 GAGGTAATTAAGATTAAATGAGG - Intergenic
957973729 3:87416803-87416825 GAAGTAATTACGATTAAATGAGG + Intergenic
958028910 3:88083129-88083151 GAAGTAATTAAGTTTAAATGAGG - Intronic
958270045 3:91488298-91488320 GAACTCATTAAGATTAAAGGAGG + Intergenic
958424657 3:93966397-93966419 GAAGTTATTAGTAATAATGATGG + Intronic
958657561 3:97021742-97021764 AAGGTTATTAACATTAAATAGGG - Intronic
958785265 3:98591011-98591033 AAAGTTCTGAAGACTAAAGATGG - Exonic
959197256 3:103200295-103200317 TGAGTTATAAAGGTTAAAGATGG - Intergenic
959621336 3:108401236-108401258 GATGTAATTAAGATTAAATGAGG + Intronic
960013373 3:112857842-112857864 GAAGTAATTAAGATTAAATGAGG - Intergenic
960238013 3:115307055-115307077 GAAATAATTAAGATTAAAAGAGG + Intergenic
960402842 3:117224925-117224947 GAAGTAATTAAGGTTAAATTAGG + Intergenic
960436214 3:117629843-117629865 GAATTTATTAAGTTAAATGATGG + Intergenic
960457771 3:117894331-117894353 GATGCTATTAAGAGCAAAGATGG - Intergenic
960703077 3:120456033-120456055 GAAGTAATTAAGGTTAAATAAGG - Intergenic
961019649 3:123494634-123494656 GAAGTTCTTAATATTTATGATGG - Exonic
961199129 3:125029886-125029908 GAAGTTATTATTTTTTAAGATGG - Intronic
961725570 3:128926732-128926754 GAAGTAATTAAGGTTAAATGAGG + Intronic
962436246 3:135369647-135369669 AAAATTATTAAAAATAAAGAAGG - Intergenic
962640913 3:137385561-137385583 GAAGTAATTAAGATTCAATGAGG - Intergenic
963276140 3:143331954-143331976 GAAATTATTGAGAGGAAAGAAGG + Intronic
963456125 3:145550182-145550204 GAAGTTATTGGCATTCAAGAGGG - Intergenic
963526720 3:146424330-146424352 GAAGTAATTAAGATTAAATGAGG - Intronic
963541299 3:146593046-146593068 GAAAATATTAATATGAAAGATGG - Intronic
963927987 3:150971641-150971663 GAAGTTATTATTATTTCAGAAGG - Intronic
963933054 3:151024246-151024268 GAAGTAATTAAGGTTAAATGAGG - Intergenic
964204262 3:154154172-154154194 AAAATTGTTAAGATCAAAGATGG - Intronic
964829794 3:160871476-160871498 GAAGAGATTAAGATTAGAGAAGG + Intronic
965623119 3:170660266-170660288 GAAGTAATTAAGACTAAATGAGG - Intronic
966028271 3:175313191-175313213 GAAGTAATTAAGGTTAAATGAGG - Intronic
966041718 3:175498837-175498859 GAAGTAATTAAGTTAAAAGAAGG + Intronic
966104089 3:176314078-176314100 GAGGTTATTAAGGTTAAATAAGG - Intergenic
966564228 3:181358478-181358500 GAGGTTATTAAGTTCATAGATGG + Intergenic
969045256 4:4331886-4331908 GAAGTAATTAAGGTTAAATGAGG + Intergenic
969109172 4:4831093-4831115 GAGGTCATTAAGGTTAAATAGGG + Intergenic
969403357 4:6971949-6971971 GAAGTTATTGTGGATAAAGATGG + Intronic
969708189 4:8825106-8825128 AAAGTTATAAGGAATAAAGAGGG + Intergenic
969916876 4:10499910-10499932 GAGGTAATTAAGGTTAAACAAGG - Intronic
969983477 4:11182510-11182532 GAAGTAATTAAGGTTAAATGAGG + Intergenic
970125444 4:12804462-12804484 AAAGTTGTTAAAATTAAAGAGGG - Intergenic
970314097 4:14812887-14812909 GAAGTAATTAAGGTTAAATGAGG - Intergenic
970831022 4:20339995-20340017 AAAGGTATTCAGATTATAGATGG - Intronic
970882769 4:20951015-20951037 AAAGTAATTAAGGTTAAATAAGG + Intronic
971103677 4:23497846-23497868 GAGGTAATTAGGATTAAATAAGG + Intergenic
971178492 4:24304965-24304987 GAAGTTATTATGGCTGAAGATGG + Intergenic
971693029 4:29862496-29862518 AAGGTTATAAAGATTATAGAAGG + Intergenic
971858568 4:32075337-32075359 GTAGTTATCAAGAATAAAGGTGG - Intergenic
971982896 4:33776893-33776915 GAAGTTAATAAGAAAATAGAAGG + Intergenic
972122509 4:35722664-35722686 GAAGTAATCAAAAATAAAGAGGG + Intergenic
973588833 4:52420092-52420114 GAAGTAATTAAGGTTAAATGAGG - Intergenic
973718624 4:53701761-53701783 GAAGTAATTAAGGTTAAATGAGG + Intronic
973904639 4:55516453-55516475 GAAGTTATCCGGAATAAAGAGGG - Intronic
974673876 4:65065363-65065385 GAAGTTAAAAAAAATAAAGAAGG - Intergenic
974924107 4:68276604-68276626 GAAGTTCTTAATTTTAATGAAGG + Intergenic
975056848 4:69944071-69944093 GAATTTTTTAAGATAAAATAAGG - Intronic
975434717 4:74337974-74337996 AAAGTGATTAAGTTTAAAGGAGG - Intergenic
975783459 4:77863399-77863421 GAAATTATTAAGATGAAAAGAGG - Intronic
975994853 4:80302512-80302534 GAAGTTGATTAGATTAAAGCTGG - Intronic
976072207 4:81254325-81254347 GAAGTACTTAAGATTAAATGAGG + Intergenic
976521637 4:86034806-86034828 GAGGTTGTCAAGATAAAAGAAGG + Intronic
976932781 4:90589183-90589205 GCATTTATTAAAATTAGAGAGGG + Intronic
977098553 4:92777634-92777656 GAAGTAATGAAGGTTAAATAAGG + Intronic
977192127 4:94014114-94014136 GAGGTAATTAAGATTAGATAAGG - Intergenic
977778338 4:100950304-100950326 GAAGATATGCAGATTAAATAAGG - Intergenic
977883131 4:102228929-102228951 GAAGTAATCATGATTAATGAGGG + Intergenic
977982077 4:103336248-103336270 GAGGTCATTAAGATTAAATGAGG - Intergenic
978083806 4:104625140-104625162 GAGATAATTAAGATTAAACAAGG + Intergenic
978178478 4:105764042-105764064 GCAGTGATAAAAATTAAAGAGGG + Intronic
979143523 4:117210019-117210041 GAAGTGATTAAGGCTAAATAAGG - Intergenic
979249316 4:118547931-118547953 GAATTTATAAAGTTTAAAAAAGG + Intergenic
979509620 4:121537545-121537567 GAAGTAATTAAGGTTAAATGAGG + Intergenic
979987151 4:127329304-127329326 GAGGTAATTAAGGTTAAATAAGG + Intergenic
980364932 4:131790504-131790526 GATGCTATGAAGGTTAAAGAAGG + Intergenic
980619071 4:135273597-135273619 GATGTTATTTAGATAGAAGATGG + Intergenic
980804407 4:137793151-137793173 GAAATTATGAAGATTAAGAAAGG + Intergenic
981495225 4:145383725-145383747 GAAGTAATTAAGCTAAAATAAGG - Intergenic
981498885 4:145425084-145425106 GAAGTAAATAAGATTAAATGAGG + Intergenic
981765942 4:148250335-148250357 GAAGTTATTAATAATTGAGAAGG - Intronic
981881601 4:149619786-149619808 GAGGTAATTAAGATTAAATGAGG + Intergenic
981949419 4:150388226-150388248 GAAGTGATTAAGGTTAAATGAGG - Intronic
981988924 4:150892352-150892374 GAAGTAATTAAGGTTAAATGCGG + Intronic
982660839 4:158204899-158204921 GAAATTATTAGGAATAAAGAAGG - Intronic
982667322 4:158281423-158281445 TAAGTTATTAAGACAAAAGGAGG + Intergenic
983733368 4:171025600-171025622 GAAATAATTAAGGTTAAATAAGG - Intergenic
984394997 4:179186175-179186197 GCAATTATTAAGATTGAGGAAGG + Intergenic
984528347 4:180884486-180884508 GAAGTTACCATGCTTAAAGAAGG + Intergenic
984679011 4:182585412-182585434 GAAGTAATTAAGGTTAAACGAGG + Intronic
985090841 4:186361275-186361297 GAAGTAATTAAGGTTAAACTAGG - Intergenic
985829517 5:2217844-2217866 GAAGTGATTAAGTTTAAATTAGG - Intergenic
986075796 5:4337012-4337034 GAAGTAATTAAGGTTAAATGAGG - Intergenic
986295224 5:6432009-6432031 GAAGTAATTGAGGTTAAACAAGG - Intergenic
986361886 5:6986429-6986451 GAAGTCATTAAGATTAAATAAGG + Intergenic
986420211 5:7572942-7572964 GAAGTAATTAAGGTTAAACAAGG + Intronic
986510392 5:8500255-8500277 GAGGTAATTAAGATAAAATAAGG + Intergenic
986756932 5:10845598-10845620 GAAATAATAAAGATTAAAGCAGG + Intergenic
987885830 5:23810458-23810480 GAAATAATTAAGATTAAATGAGG + Intergenic
988175587 5:27719763-27719785 GAAGCTATTAAAATTAATGGAGG - Intergenic
988623832 5:32850041-32850063 GAAGTAATTAAGGTTAAATGTGG + Intergenic
988942732 5:36162415-36162437 GATGTTATTAAGTTTGAACATGG - Intronic
989313469 5:40049213-40049235 GAAGGTATAAAGATAAAATAAGG - Intergenic
989724341 5:44570303-44570325 GAAGTAATTAAGGTTAAAAGAGG - Intergenic
989822369 5:45808934-45808956 GAAGCTATTAGGGCTAAAGAAGG + Intergenic
990145458 5:52755300-52755322 GAAGTTTTTATAATTACAGAAGG + Intergenic
990570944 5:57078120-57078142 AGAGTTATCAAGAATAAAGAGGG - Intergenic
991323095 5:65398380-65398402 AAAGTTATCAAGGATAAAGAAGG - Intronic
991538725 5:67703356-67703378 GAAGTAACTAAGATTAAATAAGG - Intergenic
992330313 5:75710427-75710449 AAAGTAATTAAGGTTAAATAAGG + Intronic
992376946 5:76197609-76197631 GAAGTTATTAAGGAAAATGAGGG + Intronic
992788667 5:80194044-80194066 GAAGTTTTTGAGATTAAAAGTGG - Intronic
992982434 5:82189923-82189945 AAAGTTATTCAAATTAAAAACGG - Intronic
993120026 5:83763753-83763775 GAAGTAATTAAGTTTAAATGTGG + Intergenic
993617710 5:90133881-90133903 GAGGTTATTAAGGTTAAATGAGG + Intergenic
993755532 5:91724686-91724708 GAGGTAATTAAGATTAAATGCGG + Intergenic
993851851 5:93020180-93020202 GAGGTTATTAAGTTAAAATAAGG - Intergenic
993943671 5:94093526-94093548 GAAGTCATTAAGGTTAAATGAGG - Intronic
994271957 5:97788252-97788274 GAAATTATTCAGATTTAAGCAGG - Intergenic
994311950 5:98283196-98283218 GAAGAAATTAATATTAATGAAGG - Intergenic
994342166 5:98643177-98643199 GAAGTTATTAAAATCAGATAAGG + Intergenic
994852102 5:105068810-105068832 GAAGTTATTAAAGTTAAATGAGG - Intergenic
994854818 5:105104711-105104733 GAAGTTACTTATATTTAAGAGGG + Intergenic
995164064 5:109016846-109016868 GAGGTAATTAAGGTTAAATAAGG + Intronic
995656238 5:114429587-114429609 GAAGCTTTTAAGTTTAATGAAGG + Intronic
996013833 5:118509146-118509168 GGAGTTATTTACAATAAAGAAGG + Intergenic
996024885 5:118633759-118633781 GAAAATATGAACATTAAAGAAGG - Intergenic
996141584 5:119915844-119915866 GATATTATTAAGATTAATAATGG + Intergenic
996298873 5:121958258-121958280 GATGTAATTAAGTTTAAATAAGG + Intergenic
996651972 5:125889192-125889214 GAGGTAATTAAGGTTAAATAAGG - Intergenic
996817557 5:127590556-127590578 AATGTTATGACGATTAAAGAGGG + Intergenic
997806884 5:136926984-136927006 GAAATAATTAAGGTTAAATATGG + Intergenic
998961552 5:147493078-147493100 GAAGTTATCAGAAATAAAGAGGG + Intronic
999015038 5:148093466-148093488 GAAATTATTATGGATAAAGAAGG + Intronic
999020494 5:148160453-148160475 GAAGTAATTAAGGTTAAATTAGG - Intergenic
999871610 5:155757420-155757442 AAAGTTATAAAGATTAAATGAGG - Intergenic
1000102817 5:158033164-158033186 GAAGTCATGAGGATTAAATAAGG + Intergenic
1000201210 5:159012819-159012841 GAGGTCATTAAAATTAAATAAGG + Intronic
1000282481 5:159794068-159794090 GAAGTTAGGAAGAATAAACAAGG - Intergenic
1000829000 5:166080599-166080621 GCAATAATTTAGATTAAAGATGG - Intergenic
1001072844 5:168601649-168601671 AAAGTAATTAAGGTTAAACAAGG - Intergenic
1001538353 5:172516574-172516596 AAAATTATTAAGGATAAAGAGGG + Intergenic
1001731070 5:173958810-173958832 CAATTTATTAATATTAAAAATGG - Exonic
1001859420 5:175040465-175040487 GAGGTAATTAAGATTAATTAAGG - Intergenic
1002874051 6:1195451-1195473 GAAATAATAAGGATTAAAGAGGG + Intergenic
1003259599 6:4505295-4505317 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1004488969 6:16095677-16095699 CAAGTTATTTTGATTACAGAGGG - Intergenic
1005190513 6:23216504-23216526 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1005353367 6:24959060-24959082 GAAGTTTGTAAGATCAAAGCTGG - Intronic
1005518207 6:26574471-26574493 GAAGTAGTTAAGGTTAAATAAGG + Intergenic
1005673180 6:28127500-28127522 GAAGTAATTAAGGTTGAATAAGG - Intronic
1005693639 6:28331187-28331209 GAAAATATTAAGATTCAGGATGG + Intronic
1006522105 6:34576774-34576796 GCAGTTTTTAAGATCAGAGATGG + Intergenic
1006842849 6:37041240-37041262 GAGGTAATTAAGATTAAAGGAGG + Intergenic
1007149347 6:39672794-39672816 GAAGTAATTAAGGTTAAATGAGG - Intronic
1007186765 6:39978384-39978406 GAAGTTGTTAAGAATATAGCTGG + Intergenic
1008778814 6:55075666-55075688 GAAGTTATCATGAATAAAGAGGG + Intergenic
1008874757 6:56313613-56313635 AAAGTTAATAAGATTAAGGGAGG - Intronic
1008985118 6:57533044-57533066 GAACTCATTAAGATTAAAGGAGG - Intronic
1009173152 6:60425999-60426021 GAACTCATTAAGATTAAAGGAGG - Intergenic
1009446254 6:63745826-63745848 GAAGTAATTAAGGTTAAATGAGG + Intronic
1010145850 6:72668903-72668925 AAGGTAATTAAGGTTAAAGAAGG - Intronic
1010147069 6:72682627-72682649 AAATTTATTAAGAGTAAAGTAGG - Intronic
1010433839 6:75808441-75808463 GAGGTAATTAAGATTAAATGAGG - Intronic
1010554079 6:77257711-77257733 AAGGTAATTAAGATTAAATAAGG - Intergenic
1010674652 6:78727833-78727855 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1010838627 6:80620509-80620531 GATGTTATTAAGATCTAAAAAGG - Intergenic
1010859932 6:80898342-80898364 GAGGATATCAAGATGAAAGAGGG + Intergenic
1010862158 6:80926323-80926345 GAGGTAATTAAGATTAAATGAGG + Intergenic
1011038708 6:83006394-83006416 GAGGTCATTAAGATTAAATGAGG + Intronic
1011571187 6:88737566-88737588 GAAGTAATTAAGAGTAAATGAGG + Intronic
1012015819 6:93849903-93849925 GAGGTAATTAAGCTTAAATAAGG + Intergenic
1012050720 6:94340408-94340430 GAATTTATGAAGATTAAATGAGG - Intergenic
1012160970 6:95885772-95885794 GAAGTCATTAAGGTTAAATGAGG - Intergenic
1012242186 6:96885948-96885970 CAAGTTATTAAGCAAAAAGAAGG - Intergenic
1012329559 6:97967749-97967771 AAAGTTATTAAGTTTAAAAGTGG - Intergenic
1012762991 6:103326539-103326561 TAAGTTATGAAGATTAAACTGGG + Intergenic
1012947270 6:105480956-105480978 AAAGAAATTAAGAATAAAGAAGG + Intergenic
1013122990 6:107157342-107157364 AAAGTTTTTAAAATTAAACAAGG - Intronic
1013424943 6:110003075-110003097 GAATTAATTAAGCTAAAAGAAGG - Intergenic
1013872612 6:114784654-114784676 AAAATTATAAAGATTAAAAATGG + Intergenic
1013880731 6:114896444-114896466 GAATTAATTAAAATTTAAGATGG + Intergenic
1013977962 6:116098529-116098551 GAAGTAATTAATGTTAAATAAGG - Intergenic
1014392831 6:120885034-120885056 GAAATTTTTAAAATTACAGAAGG - Intergenic
1014397538 6:120944581-120944603 GAGGTAATTAGGATTAAACAAGG - Intergenic
1014553559 6:122817666-122817688 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1014644486 6:123956344-123956366 AATGTAATTAAGATTAAATAAGG + Intronic
1014864725 6:126514573-126514595 GAAATTATCAAGAATAAAGAAGG - Intergenic
1015188269 6:130444118-130444140 AAGGTGATTAAGATTAAACAAGG - Intergenic
1015209158 6:130676836-130676858 GAGGTAATTAAGATTAAATGAGG + Intergenic
1015231068 6:130915387-130915409 GAAGTTAGTAAAAATAAAGATGG - Intronic
1016582377 6:145643724-145643746 GAAGACATTAACATTAAAAAAGG - Intronic
1016792859 6:148084346-148084368 GAAGTTATTAAGATTTGGGTTGG + Intergenic
1017059056 6:150463848-150463870 GAGGTAATTAAGTTTAAATAAGG + Intergenic
1017139856 6:151180578-151180600 GAGGTAATCAAGATTAAATACGG - Intergenic
1017660925 6:156671739-156671761 AAAGTTATCAGGAATAAAGAGGG + Intergenic
1018296108 6:162345917-162345939 GAGGTAATTAAGATTAGATAAGG + Intronic
1018649203 6:165977399-165977421 GACGGTATTAAGAAGAAAGATGG - Intronic
1020522460 7:9209456-9209478 GCAATTTTTAGGATTAAAGAAGG - Intergenic
1020562633 7:9749105-9749127 AAAGTTATTAGGGATAAAGAGGG - Intergenic
1020768266 7:12353346-12353368 GAAGTAATTAAGGTTAAATGAGG - Intronic
1021286795 7:18790311-18790333 AAAGTAATTAAGATTAAATTAGG + Intronic
1021759316 7:23887941-23887963 GAGGTAATTAAGATTAAATGAGG - Intergenic
1021808130 7:24376847-24376869 GAGGTAATTAAGATTAAACGAGG + Intergenic
1022022256 7:26412117-26412139 GAAGTGATTAAGGTTAAAGGAGG + Intergenic
1022132244 7:27415350-27415372 CAAGTTATTAAAAGGAAAGAGGG + Intergenic
1022584188 7:31589800-31589822 GAAGTTCTTTAGACCAAAGATGG + Intronic
1022859034 7:34346648-34346670 GATTTTATCAAGATTAAAAAGGG - Intergenic
1022939195 7:35215697-35215719 GATGTTTTAAAGATCAAAGAAGG - Intronic
1023725693 7:43140986-43141008 GAAGTAATTATGATTAAATGAGG - Intronic
1024190169 7:46998299-46998321 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1026686105 7:72511615-72511637 GAGGTAATTAAGATTAAATGAGG + Intergenic
1027574431 7:79914993-79915015 GAATTCATAAAGATAAAAGAAGG + Intergenic
1027748408 7:82108431-82108453 GAAGTAATTAGGATTAAATGAGG - Intronic
1027753732 7:82184737-82184759 CATGTTATTAAGAATAATGATGG + Intronic
1027941166 7:84681641-84681663 GGAGTTATTTAGCTTAAAAATGG - Intergenic
1027956840 7:84889216-84889238 GACTTTATTAATATTAGAGAAGG - Intergenic
1028061805 7:86327678-86327700 GGAATTATTAAAATTAAATATGG + Intergenic
1028104252 7:86858405-86858427 GAGGGAATTAAGATTAAATAAGG + Intronic
1028897998 7:96063664-96063686 GAAATAATTAAGATTAAATGAGG - Intronic
1029700790 7:102245606-102245628 GAAGTTATTAAGATTAAATAAGG - Intronic
1030628701 7:111871797-111871819 GAACTTATTTTGATTAAAAAGGG - Intronic
1030658489 7:112194025-112194047 GAGGTTACTAAGATTAAATGAGG - Intronic
1030704214 7:112674621-112674643 GAGGTAATTAGGATTAGAGAAGG - Intergenic
1030938504 7:115616212-115616234 GAAGTAATTAAGATTAAAGGAGG + Intergenic
1031007396 7:116489015-116489037 GAGGTTGTTTAGATTACAGAAGG - Intronic
1031276894 7:119736007-119736029 GAAGTAATTAAGCTTAAATCAGG - Intergenic
1031349006 7:120705546-120705568 AATGTTATGAAGATTAGAGATGG + Intronic
1031586542 7:123537383-123537405 GAAATTATTTAGATTAAATTTGG + Exonic
1032533524 7:132641471-132641493 GAGGTAATTAAGGTTAAATAAGG - Intronic
1034020952 7:147641630-147641652 TAAGTAATTAAGATTAAATGAGG + Intronic
1034623381 7:152473448-152473470 AAAGTTATTAAGATCATATATGG + Intergenic
1036095818 8:5724640-5724662 TAAATTATTAAGACTAGAGATGG - Intergenic
1036627319 8:10482968-10482990 GAAGTCATTAAGGTTAACTAAGG - Intergenic
1037152239 8:15651482-15651504 GAAGTAATTAAGGTTAAATGAGG + Intronic
1038867733 8:31458041-31458063 GAAGTAATTAAGTTTAAATGAGG + Intergenic
1039243016 8:35577330-35577352 GAACTTATCCAGATTAAAGAAGG - Intronic
1039415488 8:37390383-37390405 TAAGTTTTTAAGATCAAAGGGGG - Intergenic
1039626008 8:39053956-39053978 GAAGTAATTAAGGTTAAACGAGG + Intronic
1039683257 8:39765655-39765677 GATGATTTTCAGATTAAAGAAGG - Intronic
1039684773 8:39787513-39787535 AGAGTTTTTAAGATTAAACATGG - Intronic
1040082349 8:43299882-43299904 GCAGTTATTAAGAATACACATGG + Intergenic
1040430317 8:47334513-47334535 AAAGTTATCAAGGATAAAGAGGG - Intronic
1041752959 8:61281356-61281378 GAAGTAATTAAGGTTAAATGAGG + Intronic
1041937266 8:63347867-63347889 GAAGTAATTAAGGTTAAATGGGG + Intergenic
1042116295 8:65435241-65435263 GAAGAAATTAAGATTAAATGAGG + Intergenic
1042396614 8:68298811-68298833 CAAGTTTTTAATATGAAAGAGGG + Intergenic
1042418045 8:68548971-68548993 GAGGTAATTAAGGTTAAATAAGG + Intronic
1042652051 8:71053694-71053716 GAGGTTATTCAGTTGAAAGATGG + Intergenic
1042746764 8:72116830-72116852 AAAATTATCAAGAGTAAAGAGGG - Intronic
1043289245 8:78576092-78576114 GAAGTCATTTAGGTTAAATAAGG - Intronic
1043420063 8:80088726-80088748 GAGGTAATTAAGATTAAACAGGG + Intronic
1043609587 8:82045739-82045761 TAAGTTATTAATATTAAATGAGG - Intergenic
1043626312 8:82264260-82264282 AAAGTTATCAAGGATAAAGAGGG - Intergenic
1043690881 8:83150062-83150084 GAATTTATTAAGCTAAAGGAAGG - Intergenic
1043791702 8:84476172-84476194 GAAGTTGTTAACCTTAAACAGGG + Intronic
1043826302 8:84933117-84933139 GAAAATTTTAGGATTAAAGATGG + Intergenic
1044189197 8:89294637-89294659 GAGGTAATTAAGATTAAATGAGG + Intergenic
1045260032 8:100564564-100564586 GAAGTTACTAAGATAACAGTTGG + Intergenic
1045651265 8:104343548-104343570 GAAGTAATTAAGGTTAAATGAGG + Intronic
1045678087 8:104630326-104630348 GAAGTCATTAAGATTTAAAGAGG - Intronic
1046090413 8:109497065-109497087 CAGGTAATTATGATTAAAGATGG + Exonic
1046168170 8:110467750-110467772 GAAATTATTAACATTCAAAATGG - Intergenic
1046183843 8:110687782-110687804 GATGTTATTTAGTTTACAGATGG + Intergenic
1046361832 8:113169602-113169624 TAACATATTAAGATTTAAGAAGG - Intronic
1046627939 8:116595111-116595133 GAAGTAATTAAGGTTAAAGGAGG + Intergenic
1047612876 8:126538296-126538318 TAAGTAATTAAGGTTAAATAAGG + Intergenic
1048032955 8:130650277-130650299 TAAGATCTTAAGAGTAAAGAGGG + Intergenic
1048266961 8:132995875-132995897 GAAGTTAGCAGCATTAAAGATGG + Intronic
1048289152 8:133166780-133166802 GAAGGTGTTAAAAATAAAGATGG + Intergenic
1048314501 8:133352152-133352174 GAGGTAATTAAGATAAAATAAGG - Intergenic
1048651396 8:136482656-136482678 GGGGTAATTAAGATTAAATAAGG + Intergenic
1049712336 8:144070969-144070991 GAAGTTCTTAAAAATAAGGAGGG + Intergenic
1050112469 9:2231172-2231194 GAAATTATTACTATTTAAGAAGG + Intergenic
1050367113 9:4882764-4882786 GAAATTATTAAGCCTAAACATGG - Intronic
1050712552 9:8482079-8482101 GAAGTTATTAAGATTAAAGATGG - Intronic
1050804955 9:9664255-9664277 GCAGTTATTAAGTTCATAGATGG - Intronic
1050843278 9:10180855-10180877 GAAGTTAAAAATATTAATGATGG + Intronic
1051164435 9:14246875-14246897 GAAGTAATTAAGGTTAAATGAGG + Intronic
1051401337 9:16686393-16686415 GATTTTTTTAAGATTAAACAAGG + Intronic
1051455379 9:17249917-17249939 AAGGTTATTAAGGATAAAGATGG - Intronic
1051656403 9:19385975-19385997 GAAGTAATTAAGTTAAAAGGAGG - Intergenic
1051669853 9:19498477-19498499 GAAGATATTAAAATTGAAAAGGG + Intergenic
1051676146 9:19560375-19560397 GAAGTGATTAAGGTTAAATGAGG + Intronic
1052525698 9:29616137-29616159 GATGTGATTAAGGTTAAGGATGG + Intergenic
1052568827 9:30194218-30194240 CAATTTGTTAAAATTAAAGATGG + Intergenic
1053066575 9:35073241-35073263 TAAGGTATTAATATTAATGACGG - Exonic
1053826764 9:42032943-42032965 GAGGTAATTAAGGTTAAATAAGG - Intronic
1054603794 9:67154480-67154502 GAGGTAATTAAGGTTAAATAAGG + Intergenic
1054789107 9:69238446-69238468 AAAGTTATTTAGAAAAAAGAGGG - Intronic
1054991718 9:71335401-71335423 CAAGTCATTAAGTTTAAAGATGG - Intronic
1055208152 9:73758748-73758770 GAAGTTATTACAATTGTAGATGG - Intergenic
1055361900 9:75500538-75500560 GAGGTCATTAAGGTTAAATAAGG - Intergenic
1055519779 9:77069226-77069248 AAAGTTATTACGGATAAAGAGGG - Intergenic
1055661513 9:78508381-78508403 GAAGTAATTAAGGTTAAATGAGG + Intergenic
1056117988 9:83460029-83460051 GAAGTAATTAAGGTTAAATGAGG - Intronic
1057093415 9:92281894-92281916 GAGCTCTTTAAGATTAAAGAAGG + Intronic
1057326890 9:94073578-94073600 TAAGTCAGTAAGATTAAAAATGG - Intronic
1057535360 9:95897618-95897640 GAAGTTATGAAAAGAAAAGATGG + Intronic
1058054481 9:100435795-100435817 GAAGCAATTAAGGTTAAATAAGG - Intronic
1058561331 9:106232238-106232260 GAAGTTATTAAAATTTAGAAAGG - Intergenic
1058637740 9:107052987-107053009 GTGTTTATTAAGATTTAAGAAGG - Intergenic
1058845678 9:108956412-108956434 GAAGTTGTAAAGATGATAGATGG - Intronic
1059498792 9:114732620-114732642 GAGGTAATTAAGATTAAATAAGG + Intergenic
1059861370 9:118466939-118466961 GAAGTAATTAAGGTTAAATAAGG - Intergenic
1059921595 9:119166604-119166626 GAATTAATTAAGCATAAAGAGGG + Intronic
1060689517 9:125644267-125644289 TAAGTTATTTTCATTAAAGATGG + Intronic
1060800421 9:126541268-126541290 GAAATTATTAAGACTAAAAAAGG + Intergenic
1186148053 X:6645497-6645519 GAAGTTTTTAACATTAATGCTGG + Intergenic
1186188635 X:7046216-7046238 GAGGTAATTAAGGTTAAACAAGG + Intergenic
1187114870 X:16339144-16339166 GAAGTTATCAGGAATAAAGAGGG - Intergenic
1187215603 X:17273028-17273050 GAAGTAATTAAGATTAAATGAGG - Intergenic
1187280908 X:17858085-17858107 GACGTTGTAAAGATTAAAGTGGG - Intronic
1187991212 X:24875019-24875041 TAATTTATTAACATTATAGAAGG + Intronic
1188050468 X:25479054-25479076 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1188067812 X:25682878-25682900 GAGGTTATTAAGAGTAAATTTGG - Intergenic
1188115915 X:26242306-26242328 GAAAATATTAAGATTAATCATGG - Intergenic
1188228642 X:27633305-27633327 GTAAGTATTAAAATTAAAGATGG - Intronic
1188280643 X:28263862-28263884 AAAGTTATTAATGATAAAGAGGG + Intergenic
1188439380 X:30200089-30200111 GAAATTATTAAAATTAAAACAGG + Intergenic
1189364122 X:40375128-40375150 GAAGTAATTAAGGTTAGAAAGGG - Intergenic
1189420181 X:40850456-40850478 GAAGTAATTAAGGTTAAATGAGG - Intergenic
1189681859 X:43525454-43525476 GAAGTAATTAAGGTTAAGCAAGG + Intergenic
1189707355 X:43772297-43772319 GAAGGAATAAAGATAAAAGAAGG + Intronic
1190033978 X:47003348-47003370 GAGGTAATTAAGCTTAAATAAGG - Intronic
1190155731 X:47991120-47991142 GAGGTAATTAAGGTTAAATAAGG + Intronic
1190336023 X:49262216-49262238 GAAATAATCAAGAATAAAGAAGG + Intronic
1190554189 X:51617356-51617378 GTATTTAGAAAGATTAAAGAGGG + Intergenic
1191599909 X:62991352-62991374 GCAGATACTAAGATTGAAGAGGG - Intergenic
1192594177 X:72388721-72388743 GAAGTAATTAAGGTTAAATAAGG + Intronic
1193381270 X:80819060-80819082 AAAGTTATTAAAAATAAAGAGGG + Intergenic
1193473744 X:81938942-81938964 GAAGTAATTAAGATTAAATGAGG + Intergenic
1193693130 X:84672042-84672064 GAAGAAATTAAGAAAAAAGATGG + Intergenic
1194787032 X:98098843-98098865 GAAGTAATTAAGGTTAAATAAGG + Intergenic
1195197417 X:102513007-102513029 GAAGTAATTCAGATTAAATAAGG - Intergenic
1195533935 X:105989029-105989051 AAAGTTATTAGGGATAAAGATGG - Intergenic
1195536973 X:106020056-106020078 GATGTAATTAAGATTAAATGAGG + Intergenic
1195676099 X:107508012-107508034 GATGTTGTGAAGATTAAACAAGG - Intergenic
1195798347 X:108678889-108678911 GAACTGTTTCAGATTAAAGAAGG - Intronic
1196263361 X:113612278-113612300 AAAGTTATCAAGGATAAAGAGGG - Intergenic
1196357640 X:114812171-114812193 GAAGGTAGCAAGATTAAAAATGG - Intronic
1196872360 X:120125122-120125144 GAAGCAATCAAGATGAAAGAGGG - Intergenic
1196896299 X:120340100-120340122 GAGGTAATTAGGATTAGAGAAGG + Intergenic
1197104313 X:122695414-122695436 GAAATTATCAAGGGTAAAGAAGG + Intergenic
1197394539 X:125910595-125910617 AAAGCTATTAAGAATAGAGAAGG + Intergenic
1197802707 X:130368172-130368194 GAAGTTAATGAGTTTCAAGAAGG + Intronic
1198883296 X:141305559-141305581 GAAGTTGTTAATATTAAAAGAGG - Intergenic
1199072243 X:143490702-143490724 GAAATTATCAGGAATAAAGAGGG - Intergenic
1199845766 X:151692232-151692254 GAGGTTATTAAGGTAAAATAGGG - Intergenic
1199949319 X:152694100-152694122 GAAGTAATTAATATTAAAAGAGG - Intergenic
1199960357 X:152774349-152774371 GAAGTAATTAATATTAAAAGAGG + Intergenic
1201734049 Y:17238163-17238185 GAAGTTTTTAAAGTTAATGAAGG - Intergenic
1202143239 Y:21751083-21751105 GAGGTTATTATGACTAAAGTAGG - Intergenic