ID: 1050718027

View in Genome Browser
Species Human (GRCh38)
Location 9:8552363-8552385
Sequence TGTCAAAAACTCTCTCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050718027_1050718028 -2 Left 1050718027 9:8552363-8552385 CCAGCGTGAGAGAGTTTTTGACA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1050718028 9:8552384-8552406 CAGAGTATGACATGTGTTTTTGG No data
1050718027_1050718029 4 Left 1050718027 9:8552363-8552385 CCAGCGTGAGAGAGTTTTTGACA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1050718029 9:8552390-8552412 ATGACATGTGTTTTTGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050718027 Original CRISPR TGTCAAAAACTCTCTCACGC TGG (reversed) Intronic
906653891 1:47533806-47533828 GGGCAAACGCTCTCTCACGCTGG - Intergenic
907000393 1:50846743-50846765 TGTCAAACACCCTCTGACCCAGG + Intronic
913150545 1:116038136-116038158 TCACAACAACTCTCTCATGCTGG + Intronic
913402518 1:118451769-118451791 TGGCAAAAACTCTCTCATTTGGG + Intergenic
914779981 1:150776658-150776680 TGTTAAAAACTCACTCCAGCTGG + Intergenic
915328355 1:155092924-155092946 TGTCTATAACACACTCACGCAGG + Intergenic
919565208 1:199176434-199176456 GGACAAAAACTCTCACACGTAGG - Intergenic
924028039 1:239858171-239858193 TTTCAATAGCTCTCCCACGCTGG + Intronic
1064324119 10:14333011-14333033 TGACACAAAATCTCTCAGGCCGG - Intronic
1076040518 10:127243726-127243748 TCTTAAAAAATCTCTCTCGCAGG - Intronic
1084839663 11:71835175-71835197 TATGAATAACTCTGTCACGCAGG + Intronic
1095560020 12:43552910-43552932 CGGCAAAAACTCTCGCAGGCAGG - Intergenic
1100438011 12:94589550-94589572 TGTTAAAAACTCTCTGAGGTAGG + Intronic
1101815048 12:108139823-108139845 TAACAGAAACTCTCTCACACTGG + Intronic
1103897518 12:124283172-124283194 TGTCCAGAATTCTCTCAAGCAGG + Intronic
1108508451 13:51134239-51134261 CATCAAAAACTCACTCACTCAGG + Intergenic
1110759470 13:79215308-79215330 TGTCAAAAAATATCTCACAAAGG - Intergenic
1116931035 14:50691107-50691129 TTTCAAGAACTCTATCACCCAGG + Intergenic
1118588783 14:67384130-67384152 TGTGATAAATTCTCTCACACAGG - Exonic
1119504072 14:75156647-75156669 TTTGAAAAACTATCTCAGGCCGG + Intronic
1120205080 14:81579314-81579336 TGTTAAAAAGTCTCACACACAGG + Intergenic
1129002073 15:72343368-72343390 TCTCAAAAACTCTGTCGCCCAGG - Exonic
1130791840 15:87163543-87163565 TCTCAACAACTCTCCCAAGCAGG - Intergenic
1131597266 15:93811189-93811211 TGTCAAAAACTATTTCACAATGG + Intergenic
1132796051 16:1723396-1723418 TCTCAAACACTCACTCAGGCTGG + Intronic
1144414265 17:15031488-15031510 TGGCATAAACTCTCTCACCATGG - Intergenic
1151055773 17:71029793-71029815 TGACAAACACTATCTCACCCAGG + Intergenic
1152466188 17:80467938-80467960 TGTCAACAGCTCTCCCACCCCGG + Exonic
1153927449 18:9846647-9846669 TGCCAAAAACGATCTCAGGCAGG - Intronic
1157145839 18:45161519-45161541 TGTCAATAACTCTTTCAAGATGG - Intergenic
1165583052 19:36886335-36886357 TGACAAACACTCCCTCACTCAGG + Intronic
931232201 2:60384348-60384370 TGTCATAAACTCTCTAAGGACGG - Intergenic
932502937 2:72200191-72200213 AGTCTAAAAATCTCTCAAGCCGG - Intronic
937951725 2:127393279-127393301 TGACAAACACTATCTCAGGCAGG - Intergenic
938543111 2:132302779-132302801 TGTCAAAAAGGCTCGCAGGCTGG - Intergenic
942218149 2:173742850-173742872 ATTCAAAATCTCTCTCACTCAGG + Intergenic
944622126 2:201526724-201526746 TGTCAAAAACTCTCAAAAGACGG + Intronic
946517636 2:220430557-220430579 AGTCAAAAACTCTCTCTAGCTGG + Intergenic
1171871994 20:30535613-30535635 TGTCAAAAAGGCTCCCAGGCTGG - Intergenic
1172388749 20:34552022-34552044 TCTCAAAATCTCTGTCACCCAGG + Intronic
1175652486 20:60737606-60737628 TATCTGAAACTCTCACACGCTGG - Intergenic
1178616873 21:34142501-34142523 TGTCAAACACCCTCTGACCCAGG + Exonic
1179162563 21:38910186-38910208 TCTCAAAAACTGACTCACGCCGG - Intergenic
1182754925 22:32671661-32671683 TGTCACACACGCTCTCACACAGG + Intronic
964615213 3:158656489-158656511 TGTCAAACACTATCTCAGCCAGG - Intronic
965007688 3:163045636-163045658 TGTCAAAAACTGTCTGAAGCTGG + Intergenic
967622781 3:191652989-191653011 TGTCAAAGTTTCTCTCAGGCAGG - Intergenic
970001035 4:11366404-11366426 TTTCAAAAACCCTCTCCAGCTGG + Intergenic
971856175 4:32046709-32046731 TGTCAAAAACTATCACAAGAGGG - Intergenic
974353572 4:60782711-60782733 TGTTAAAAATTCTCTTACTCAGG - Intergenic
976292160 4:83430950-83430972 TGTCAAAAACTTTTTCAGGGAGG - Intronic
980229395 4:130029597-130029619 GGTCAAATACTCTCTCCCTCAGG + Intergenic
981784831 4:148465425-148465447 TGTCTCAAAGTCTCTCACACTGG + Intergenic
994292579 5:98046427-98046449 TGGCAAAAATTTTCTCACGTTGG - Intergenic
997194931 5:131973056-131973078 TGAAAAAAAATCTCTCCCGCAGG + Intronic
1005574975 6:27182214-27182236 TATCAAAAACTCACTCAAGAAGG + Intergenic
1013177542 6:107690381-107690403 TGACAAAGAATCTCTCCCGCGGG - Intergenic
1013569852 6:111411100-111411122 TCTCAAAAGCCCTCTCACTCTGG + Intronic
1014638858 6:123883439-123883461 TCACAAGAACTCACTCACGCCGG - Intronic
1015719853 6:136229725-136229747 TGTCAAAAACAATCACAGGCTGG + Intergenic
1016616600 6:146056177-146056199 TTTCTAAAACTATCTCACACAGG + Intronic
1020071606 7:5230555-5230577 GGCCACAAACTCTCTCAAGCTGG - Intronic
1020335435 7:7058910-7058932 TATCAAAGACACTCTCACACGGG + Intergenic
1020945518 7:14600890-14600912 TGCCAACAGCTCTCTCAGGCTGG + Intronic
1022290294 7:28995822-28995844 TGTCAAAAGCTCTCAGAGGCTGG + Exonic
1022578251 7:31520277-31520299 TGACAAACACTATCTCAGGCAGG - Intronic
1030428110 7:109406344-109406366 TGTCTATAACTCTCTGACTCTGG + Intergenic
1030430666 7:109443384-109443406 TCTCAAAAACTTTGTCAAGCTGG + Intergenic
1031131713 7:117840499-117840521 TGTCTCAAACTCTGTCACCCAGG - Intronic
1031536184 7:122936169-122936191 TGACACAAACTCTCTCCCACTGG + Intergenic
1035742217 8:1937043-1937065 TGTCAAAAAAAGACTCACGCGGG - Intronic
1036278184 8:7375116-7375138 TATGAATAACTCTGTCACGCAGG + Intronic
1036838678 8:12097537-12097559 TATGAATAACTCTGTCACGCAGG - Intergenic
1037666308 8:20973045-20973067 TTTCAAATACTCTCTCCCTCTGG - Intergenic
1050718027 9:8552363-8552385 TGTCAAAAACTCTCTCACGCTGG - Intronic
1059248147 9:112865801-112865823 GGTCAAAAACTCTGTTACCCAGG + Intronic
1060414430 9:123420545-123420567 TGTCAACGACTCTCTCCGGCTGG + Intronic
1186130508 X:6460697-6460719 TGTCAAAAACTCAGTTATGCAGG - Intergenic
1186379396 X:9041867-9041889 TGTCAGAAACTCATTCACACTGG - Intronic
1188317150 X:28688932-28688954 TGTCAATAACTCTCTCATTATGG - Intronic
1188708736 X:33367245-33367267 AGTCAAAAACTATCTGATGCTGG - Intergenic
1200310878 X:155076112-155076134 TGTAAAGAACTCTCTGAGGCCGG + Intronic