ID: 1050718028

View in Genome Browser
Species Human (GRCh38)
Location 9:8552384-8552406
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050718027_1050718028 -2 Left 1050718027 9:8552363-8552385 CCAGCGTGAGAGAGTTTTTGACA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1050718028 9:8552384-8552406 CAGAGTATGACATGTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr