ID: 1050719278

View in Genome Browser
Species Human (GRCh38)
Location 9:8566901-8566923
Sequence TTTTACTTGGAGCAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050719278_1050719283 30 Left 1050719278 9:8566901-8566923 CCTGGTTGCTGCTCCAAGTAAAA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1050719283 9:8566954-8566976 ACCTGAAATACCCTTTTGCAAGG No data
1050719278_1050719282 -3 Left 1050719278 9:8566901-8566923 CCTGGTTGCTGCTCCAAGTAAAA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1050719282 9:8566921-8566943 AAAACTTCATTCTTGATTTGGGG No data
1050719278_1050719281 -4 Left 1050719278 9:8566901-8566923 CCTGGTTGCTGCTCCAAGTAAAA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1050719281 9:8566920-8566942 AAAAACTTCATTCTTGATTTGGG No data
1050719278_1050719280 -5 Left 1050719278 9:8566901-8566923 CCTGGTTGCTGCTCCAAGTAAAA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1050719280 9:8566919-8566941 TAAAAACTTCATTCTTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050719278 Original CRISPR TTTTACTTGGAGCAGCAACC AGG (reversed) Intronic
901558563 1:10051180-10051202 TTTTATTTGGAGCAACAAATTGG + Intronic
901878808 1:12181943-12181965 TTTTGCTTAGAGCATCAACCAGG + Intronic
902323890 1:15685619-15685641 TTTTACTTGAAGAAGCAAAATGG + Intronic
905665155 1:39759130-39759152 TTCTCCTTGGAGCAGCCACTGGG - Exonic
908251457 1:62269108-62269130 TATTGCTTGGAGCAGCAAAAAGG + Intronic
910713274 1:90203748-90203770 GTTTACTTGGATCAGTAACTTGG - Intergenic
912537038 1:110382128-110382150 TTTTATTTGGAGCTGTAACAGGG - Intronic
921927153 1:220720686-220720708 TTTTTCTTAAAGCACCAACCTGG + Intergenic
923565739 1:235074512-235074534 TTTATCTTGAAGCAGCAGCCTGG - Intergenic
1065968666 10:30788603-30788625 TTTTAGGTGAAGCAGAAACCTGG + Intergenic
1066548035 10:36523022-36523044 TTTTGTTGGGATCAGCAACCGGG + Exonic
1068106793 10:52628272-52628294 TTTCACATAGATCAGCAACCTGG + Intergenic
1070497072 10:77034353-77034375 TTGAACATGGAGCAGAAACCAGG - Intronic
1073558912 10:104480698-104480720 TTTTGCTTGGGGCAGACACCAGG - Intergenic
1074237003 10:111595101-111595123 TTTTATTTGGATCAGCAAAGAGG - Intergenic
1074399975 10:113134007-113134029 TTTTACTTGGAGAAACAAGGTGG - Intronic
1074900832 10:117815320-117815342 TTTTATTAGGAGTAGCAAGCCGG - Intergenic
1075518875 10:123132134-123132156 TTCTCCTTGGAGCAGCTTCCTGG - Intergenic
1077669420 11:4144311-4144333 TTTCATTTGGAGCAGCACACTGG + Intergenic
1079045552 11:17099275-17099297 GTTTACTTGCAGCAGTGACCAGG + Intronic
1081634852 11:44714267-44714289 TTTTACTCTGAGAAGCAACAGGG + Intergenic
1086998467 11:93387452-93387474 TTTTAGTTGTAGAAGCACCCTGG + Intronic
1089286740 11:117412274-117412296 TTTGACTTGCAGGAGCCACCAGG + Exonic
1090118820 11:124002873-124002895 TCTTTCTTGGAGCAGCATCTTGG - Intergenic
1090167510 11:124566038-124566060 GTTTACTTGGTGCAGCAGCAGGG + Intergenic
1092036840 12:5343502-5343524 TTTGCCTTGGAGCAGAGACCAGG - Intergenic
1094764229 12:33573856-33573878 GATTACTTGGAGGAGCTACCTGG - Intergenic
1098225430 12:68317247-68317269 TTGTACTTGGAGAAGCCAGCAGG - Intronic
1099124958 12:78742666-78742688 GTTTACTTGGAGTAGAAAACTGG + Intergenic
1101044957 12:100795267-100795289 TTGTCCTTGAAGCAGCAGCCGGG + Intronic
1108262901 13:48676056-48676078 TCTTACTGGGAGCTGCAAACCGG + Intronic
1112679126 13:101741792-101741814 TTTTAGTTGCAGCAGCAAACTGG - Intronic
1112996329 13:105578672-105578694 TTTTACTAGGAGCAGCAAAGAGG + Intergenic
1117813447 14:59572941-59572963 TTTTATTTGGAACAGAAACTGGG + Intronic
1126862200 15:52896344-52896366 TATTAATTTGAGCAGCACCCTGG + Intergenic
1128264831 15:66256553-66256575 TTTTTCTGGCAGCATCAACCAGG - Intergenic
1144409565 17:14987477-14987499 TTTTACTGAAGGCAGCAACCAGG - Intergenic
1145254490 17:21315195-21315217 TTTTAATTAAAACAGCAACCAGG - Exonic
1145322107 17:21772765-21772787 TTTTAATTAAAACAGCAACCAGG + Intergenic
1151392313 17:73795625-73795647 TTTTCCCTGGAGCAGCTCCCAGG + Intergenic
1151953295 17:77367183-77367205 CTGTACTGGGAGCAGCCACCAGG - Intronic
1152109318 17:78348711-78348733 TTTTACTTCCAGAAGCAAACAGG - Intergenic
1152478133 17:80531839-80531861 ATTTACTGGGGGCAGCAGCCGGG + Intergenic
1155830957 18:30514185-30514207 TGTTCCATGGAGCAGCAGCCTGG + Intergenic
1156920420 18:42515671-42515693 TTTTTCATGGAGCTGCAACTAGG + Intergenic
1157989042 18:52473294-52473316 TTTTAACTGGAGAAGCAACATGG - Intronic
1159770622 18:72542717-72542739 ATTTCCTTGGAGCAGCACCAAGG + Intronic
1164108620 19:22133771-22133793 TATTACTAGGAGCAGCACCCAGG + Intergenic
933973473 2:87489263-87489285 TTCTCCATGGAGCAGCTACCTGG - Intergenic
936320252 2:111460950-111460972 TTCTCCATGGAGCAGCTACCTGG + Intergenic
938734526 2:134174266-134174288 TTTTACTTGTACCAGGAACATGG - Intronic
939456355 2:142441949-142441971 TTTTACCTGGTGCTGCACCCTGG - Intergenic
940493040 2:154389721-154389743 TTTAACTGGGTGCTGCAACCAGG + Intronic
941003796 2:160226845-160226867 TTTTAGCTGGAGCAGCAAGGAGG - Intronic
943732644 2:191319244-191319266 CTTTACTTAGAGTGGCAACCAGG + Intronic
947417763 2:229915864-229915886 TTTTACTTTTAGTAGCAACAAGG + Intronic
1171050390 20:21852746-21852768 TTTTCCTTGGTGAAACAACCAGG - Intergenic
1181151578 22:20887384-20887406 TTTTACTAGGAACAGCAGCCAGG - Intronic
1181493591 22:23275588-23275610 TGCTTCTTGGAGCAACAACCGGG + Intronic
1183790713 22:40066470-40066492 TTTGATTTTGAGGAGCAACCAGG + Intronic
1184030408 22:41891066-41891088 TTTCTCCTGGAGCAGCCACCAGG + Intronic
950831669 3:15880381-15880403 TTTTACTTGTAGGAGAAACTAGG - Intergenic
958717238 3:97799925-97799947 TCTTACTTGGGACAGCAACCAGG + Intronic
959639287 3:108614326-108614348 TGCTACTTGGAGTAGCTACCTGG + Intronic
959675818 3:109034473-109034495 TTTTACTTTGATAAGCAAGCAGG - Intronic
959854022 3:111126992-111127014 TATTACTTGCAGCCACAACCAGG - Intronic
962967413 3:140367601-140367623 TTTTACTTCTAGCACCTACCTGG + Intronic
963278505 3:143357457-143357479 TTTTACTTTCAGTAGCAAGCAGG - Intronic
967775032 3:193377620-193377642 TTTTCCTTAGAGTAGCAAACAGG + Intronic
968390466 4:188255-188277 TTTTATTTGAAGAAGCAGCCTGG + Intergenic
982514698 4:156330459-156330481 TTTTGCTTGGATCATGAACCAGG - Intergenic
987211268 5:15686018-15686040 TTTGCCATAGAGCAGCAACCAGG + Intronic
989174851 5:38513836-38513858 CTTAACTGTGAGCAGCAACCAGG + Intronic
991542765 5:67748129-67748151 TTTTACAGGGAGCTGCAGCCCGG - Intergenic
998643703 5:144039886-144039908 TTTCCCTTGCAGTAGCAACCTGG - Intergenic
998668560 5:144327351-144327373 TTAGACTTGGAGGAGCAATCAGG - Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999921689 5:156328662-156328684 TTGTACTTGGAGGAGGGACCTGG + Intronic
1003880349 6:10474981-10475003 TGTTGCTTAGAGCAGCAACCTGG + Intergenic
1006215128 6:32434977-32434999 CTTTACTTGGAACATCATCCAGG + Intergenic
1008379033 6:50822098-50822120 TTTGATTTTGAGCAGTAACCAGG + Intronic
1022358526 7:29638364-29638386 TTTTCCCTGGAGGATCAACCCGG - Intergenic
1024391093 7:48813391-48813413 TTTTAAGTGTATCAGCAACCAGG - Intergenic
1024795574 7:53015562-53015584 TTTTGCTTTGAGCTGCAACATGG - Intergenic
1027598537 7:80208734-80208756 TTTTACTATAAGCAGCAAGCAGG + Intronic
1030158879 7:106486729-106486751 TTTTACTTGGAAAAGAAACTAGG - Intergenic
1034023151 7:147667781-147667803 TTTTTTTTGCAGCAGCAGCCTGG - Intronic
1036583719 8:10102878-10102900 TTGTACTGGGTGCAGTAACCTGG + Intronic
1036945522 8:13091101-13091123 CTTTACTTGGAAAAGCAGCCGGG - Intronic
1044921357 8:97172758-97172780 TTTTTCTTGGTGCAGTAACTAGG + Intergenic
1045953830 8:107883680-107883702 TTTTGCTTGGAGCTGTAACTTGG + Intergenic
1046957180 8:120073753-120073775 TTTTTCTTTGAGCAGAAACATGG + Intronic
1049741038 8:144241021-144241043 CCTTACTTGAAGCAGCACCCAGG - Exonic
1050623440 9:7478354-7478376 TTTTCCTGGGGGCAGCAGCCGGG - Intergenic
1050719278 9:8566901-8566923 TTTTACTTGGAGCAGCAACCAGG - Intronic
1052410978 9:28120632-28120654 TTTTACTTGATGCAGCAATATGG + Intronic
1056046355 9:82721451-82721473 TTTTACTTGGAGAAGCAGGAGGG - Intergenic
1059050681 9:110921659-110921681 CTTTTCTTGGAGTATCAACCCGG - Intronic
1186533342 X:10319849-10319871 TTTCAGTTGGAGCAGGAAACAGG + Intergenic
1191767435 X:64713509-64713531 TCTTTCTTGGAGCAGGCACCAGG + Intergenic
1199691341 X:150311136-150311158 TTTGACCTGGAGCAGTGACCTGG - Intergenic